Analysis of a human placental lactogen gene promoter

Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^

Nuclear proteins interacting with an AP-1/CRE-like promoter sequence in the human TNF$\alpha$ gene

Monocyte developmental heterogeneity is reflected at the cellular level by differential activation competence, at the molecular level by differential regulation of gene expression. LPS activates monocytes to produce tumor necrosis factor-$\alpha$ (TNF). Events occurring at the molecular level necessary for TNF regulation have not been elucidated, but depend both on activation signals and the maturation state of the cell: Peripheral blood monocytes produce TNF upon LPS stimulation, but only within the first 72 hours of culture. Expression of c-fos is associated with monocytic differentiation and activation; the fos-associated protein, c-jun, is also expressed during monocyte activation. Increased cAMP levels are associated with down regulation of macrophage function, including LPS-induced TNF transcription. Due to these associations, we studied a region of the TNF promoter which resembles the binding sites for both AP-1(fos/jun) and CRE-binding protein (or ATF) in order to identify potential molecular markers defining activation competent populations of monocytic cells.^ Nuclear protein binding studies using extracts from THP-1 monocytic cells stimulated with LPS, which stimulates, or dexamethasone (Dex) or pentoxyfilline (PTX), which inhibit TNF production, respectively, suggest that a low mobility doublet complex may be involved in regulation through this promoter region. PTX or Dex increase binding of these complexes equivalently over untreated cells; approximately two hours after LPS induction, the upper complex is undetectable. The upper complex is composed of ATF2 (CRE-BP1); the lower is a heterodimer of jun/ATF2. LPS induces c-jun and thus may enhance formation of jun-ATF2 complexes. The simultaneous presence of both complexes may reduce the amount of TNF transcription through competitive binding, while a loss of the upper (ATF2) and/or gain of the lower (jun-ATF2) allow increased transcription. AP-1 elements generally transduce signals involving PKC; the CRE mediates a cAMP response, involving PKA. Thus, this element has the potential of receiving signals through divergent signalling pathways. Our findings also suggest that cAMP-induced inhibition of macrophage functions may occur via down regulation of activation-associated genes through competitive binding of particular cAMP-responsive nuclear protein complexes. ^

The effect of v-{\it mos\/} expression on the regulation of the {\it fos\/} promoter in 490N3T cells

The v-mos oncogene acquired by Moloney murine sarcoma viruses by recombination with the c-mos proto-oncogene encodes a 37kD cytoplasmic serine/threonine protein kinase which can phosphorylate tubulin and vimentin, as well as the cyclin B component of the maturation promotion factor complex (MPF). Our earliest experiments asked whether the v-mos protein could activate the transcription of transin. Since the transcription of transin was known to be mediated by both fos-dependent and fos-independent pathways, it seemed possible that the induction of transin transcription by v-mos might be mediated by p55$\sp{\rm c-}\sp{fos}$. Surprisingly, when we examined the effect of v-mos on the fos promoter, we observed a significant inhibition of transcription in 49ON3T cells, a subclone of N1H3T3 mouse fibroblasts.^ In this thesis we show that in mouse 49ON3T cells, transcription from the fos promoter is up to 10-fold repressed in the presence of v-mos. Moreover, in this cell line several other transforming constructs (v-ras, v-src, neu) also cause repression of the fos promoter. Interestingly, nontransforming oncogenes (e.g. myc) do not repress fos transcription. The repressive effect was lost in v-mos mutants lacking in ATP-binding or kinase domain, arguing that the effect on fos transcription was mediated by v-mos transforming kinase activity. As mos is a cytoplasmic protein, it was assumed that transcriptional repression was mediated by conversion of a transcriptional regulator to a repressor by mos-induced phosphorylation. As a first approximation of the identity of this factor, we mapped the position of the mos effect on the fos promoter using reporter (CAT) constructs. We found that repression was mediated by regions $-$221 to $-$106 and $-$122 to $-$65 relative to the fos transcriptional start site, both of which regions regulate baseline fos transcription. There are direct repeats containing E2F transcriptional activator/repressor recognition motifs in these regions which bind similar nuclear proteins independently of v-mos presence or absence. Our data show that the contribution of the direct repeat to baseline fos transcription is mediated by these E2F sites with perhaps some contribution from the overlapping retinoblastoma control element (RCE). We have shown that there is a separate DNA protein interaction in the direct repeat which is more pronounced in the presence of v-mos. The recognition site for this protein, which we speculate mediates the mos-induced downregulation of fos transcription, overlaps but is distinct from the E2F and RCE binding sites. (Abstract shortened by UMI.) ^

Characterization of the human tissue transglutaminase gene promoter

Transglutaminases are a family of calcium-dependent enzymes, that catalyze the covalent cross-linking of proteins by forming $\varepsilon(\gamma$-glutamyl)lysine isopeptide bonds. In order to investigate the molecular mechanisms regulating the expression of the tissue transglutaminase gene and to determine its biological functions, the goal of this research has been to clone and characterize the human tissue transglutaminase promoter. Thirteen clones of the tissue transglutaminase gene were obtained from the screening of a human placental genomic DNA library. A 1.74 Kb fragment derived from DNA located immediately upstream of the translation start site was subcloned and sequenced. Sequence analysis of this DNA fragment revealed that it contains a TATA box (TATAA), a CAAT box (GGACAAT), and a series of potential transcription factor binding sites and hormone response elements. Four regions of significant homology, a GC-rich region, a TG-rich region, an AG-rich region, and HR1, were identified by aligning 1.8 Kb of DNA flanking the human, mouse, and guinea pig tissue transglutaminase genes.^ To measure promoter activity, we subcloned the 1.74 Kb fragment of the tissue transglutaminase gene into a luciferase reporter vector to generate transglutaminase promoter/luciferase reporter constructs. Transfection experiments showed that this DNA segment includes a functional promoter with high constitutive activity. Deletion analysis revealed that the SP1 sites or corresponding sequences contribute to this activity. We investigated the role of DNA methylation in regulating the activity of the promoter and found that in vitro methylation of tissue transglutaminase promoter/luciferase reporter constructs suppressed their basal activity. Methylation of the promoter is inversely correlated with the expression of the tissue transglutaminase gene in vivo. These results suggest that DNA methylation may be one of the mechanisms regulating the expression of the gene. The tumor suppressor gene product p53 was also shown to inhibit the activity of the promoter, suggesting that induction of the tissue transglutaminase gene is not involved in the p53-dependent programmed cell death pathway. Although retinoids regulate the expression of the tissue transglutaminase gene in vivo, retinoid-inducible activity can not be identified in 3.7 Kb of DNA 5$\sp\prime$ to the tissue transglutaminase gene.^ The structure of the 5$\sp\prime$ end of the tissue transglutaminase gene was mapped. Alignment analysis of the human tissue transglutaminase gene with other human transglutaminases showed that tissue transglutaminase is the simplest member of transglutaminase superfamily. Transglutaminase genes show a conserved core of exons and introns but diverse N-terminuses and promoters. These observations suggest that key regulatory sequences and promoter elements have been appended upstream of the core transglutaminase gene to generate the diversity of regulated expression and regulated activity characteristic of the transglutaminase gene family. ^

Human TNF receptor p75/80 gene structure and promoter characterization

Tumor necrosis factor receptor p75/80 ((TNF-R p75/80) is a 75 kDa type 1 transmembrane protein expressed predominately on cells of hematopoietic lineage. TNF-R p75/80 belongs to the TNF receptor superfamily characterized by cysteine-rich extracellular regions composed of three to six disulfide-linked domains. In the present report, we have characterized, for the first time, the complete gene structure for human TNF-R p75/80 which spans approximately 43 kbp. The gene consists of 10 exons (ranging from 34 bp to 2.5 kbp) and 9 introns (343 bp to 19 kbp). Consensus elements for transcription factors involved in T cell development and activation were noted in the 5$\sp\prime$ flanking region including TCF-1, Ikaros, AP-1, CK-2, IL-6RE, ISRE, GAS, NF-$\kappa$B and SP1, as well as an unusually high GC content and CpG frequency that appears characteristic of some TNF-R family members. The unusual (GATA)$\sb{\rm n}$ and (GAA)(GGA) repeats found within intron 1 may prove useful for further genome analysis within the 1p36 chromosomal locus. The human TNF-R p75/80 gene structure will permit further assessment of its involvement in normal hematopoietic cell development and function, autoimmune disease, and non-random translocations in hematopoietic malignancies. The region 1.8 kb 5$\sp\prime$ of the ATG was able to drive luciferase expression when transfected into cell lines expressing TNF-R p75/80. Further characterization of the 5$\sp\prime$-regulatory region will aid in determining factors and signal transduction pathways involved in regulating TNF-R p75/80 expression. ^

A urokinase receptor promoter element (-152/-135) bound with an AP-2-alpha-related protein and SP1 is required for the induction of gene expression by PMA and SRC

The urokinase-type plasminogen activator receptor (u-PAR) promotes extracellular matrix degradation, invasion and metastasis. A first objective of this dissertation was to identify cis-elements and trans-acting factors activating u-PAR gene expression through a previously footprinted (–148/–124) promoter region. Mobility shifting experiments on nuclear extracts of a high u-PAR-expressing colon cancer cell line (RKO) indicated Sp1, Sp3 and a factor similar to, but distinct from, AP-2α bound to an oligonucleotide spanning –152/–135. Mutations preventing the binding of the AP-2α-related factor reduced u-PAR promoter activity. In RKO, the expression of a dominant negative AP-2 (AP-2αB) diminished u-PAR promoter activity, protein and u-PAR mediated laminin degradation. Conversely, u-PAR promoter activity in low u-PAR-expressing GEO cells was increased by AP-2αA expression. PMA treatment, which induces u-PAR expression, caused an increased amount of the AP-2α-related factor-containing complex in GEO, and mutations preventing AP-2α-like and Sp1/Sp3 binding reduced the u-PAR promoter stimulation by PMA. In resected colon cancers, u-PAR protein amounts were related to the amount of the AP-2α-related factor-containing complex. In conclusion, constitutive and PMA- inducible u-PAR gene expression and -proteolysis are mediated partly through transactivation via a promoter sequence (–152/435) bound with an AP-2α-related factor and Sp1/Sp3. ^ A second interest of this dissertation was to determine if a constitutively active Src regulates the transcription of the u-PAR gene, since c-src expression increases invasion in colon cancer. Increased u-PAR protein and laminin degradation paralleling elevated Src activity was evident in SW480 colon cancer cells stably expressing a constitutively active Src (Y- c-src527F). Nuclear run-on experiments indicated that this was due largely to transcriptional activation. While transient transfection of SW480 cells with Y-c-src527F induced a u-PAR-CAT-reporter, mutations preventing Sp1-binding to promoter region –152/435 abolished this induction. Mobility shift assays revealed increased Sp1 binding to region –152/135 with nuclear extracts of Src-transfected SW480 cells. Finally, the amounts of endogenous u-PAR in resected colon cancers significantly correlated with Src-activity. These data suggest that u-PAR gene expression and proteolysis are regulated by Src, this requiring the promoter region (–152/–135) bound with Sp1, thus, demonstrating for the first time that transcription factor Sp1 is a downstream effector of Src. ^

Transcriptional regulation of the human Fas (CD95) promoter

The coordination of the apoptotic program necessitates the timely expression of sensor, effector, and mediator molecules. Fas/CD95, a transmembrane receptor which tethers the cell-death machinery, triggers apoptosis to maintain immune homeostasis, tolerance, and surveillance. Dysregulation in Fas-mediated apoptosis, either from disproportionate expression or disruptions in the downstream signaling pathway, manifests in autoimmune disorders and certain malignant progression. ^ In this project, the transcriptional requirements underlying two modulators of Fas expression were investigated. In T-lymphocytes, activation results in potent Fas upregulation followed by an acquisition of sensitivity towards FasL-mediated apoptosis. Human fas promoter cloning and analysis have identified a cis-element critical for inducible Fas expression. EMSA studies using this region demonstrated a constitutive association with the transcription factor Sp1 and inducible NF-κB binding in response to activation. These interactions were mutually exclusive, as the rB/Sp1 element bound with recombinant Sp1 was readily displaced by increasing amounts of NF-κB p50. Thus, Fas upregulation by T-cell activation stimuli is dependent upon NF-κB binding at the fas promoter. ^ The capacity of Sp1 to direct basal Fas expression was examined through mutagenesis of several GC-rich regions within the core fas promoter. Reporter analysis of single or combinatorial mutant GC-box constructs revealed usage of a particular GC-element in moderating over 50% of basal fas transcription. Inducible expression was Sp1-independent, however, since activated Jurkat cells containing fas Sp1-mutant constructs retained equivalent reporter induction. Overall, a dual-level of transcriptional control exists in fas, where constitutive activity is monitored through Sp1 binding, whereas T-cell activation obligates NF κB transactivation. ^ In response to genotoxic damage, p53 modulates Fas levels partly by a transcription-dependent mechanism. Reconstitution of wild-type p53 in the hepatoma cell line Hep3B readily induced Fas transcription. Furthermore, fas promoter analysis identified an undescribed p53 responsive element which, when deleted, ablated p53-mediated reporter activity. Therefore, the pro-apoptotic function mediated by p53 is driven partially through the enhancement of Fas expression. ^ Altogether, events elicting Fas transcription may invoke single or overlapping mechanisms that converge at the level of promoter activity. Agents that enhance or attenuate these pathways may be therapeutically beneficial in modulating the expression and sensitivity towards Fas-dependent apoptosis. ^

Transcriptional upregulation of the p21Cip1 promoter by STAT3 and nuclear ErbB2

Over-expression of the receptor tyrosine kinase ErbB2 is prevalent in approximately 30% of human breast carcinomas and confers Taxol resistance. In breast cancer cells, Taxol induces tubulin polymerization and hyperstable microtubule formation. This in turn prematurely activates Cdc2 kinase allowing early entry into the G2/M phase of the cell cycle resultant in mitotic catastrophe followed by apoptosis. Over-expression of ErbB2 upregulates p21Cip1, which inhibits Cdc2 activation, and leads to Taxol resistance in patients. However, the mechanism of ErbB2-mediated p21 Cip1 upregulation is unclear. Here in this study, we investigated the mechanism of ErbB2 downstream signaling events leading to upregulation. The CDKN1A (p21Cip1) gene promoter contains numerous cis-elements including a Signal transducer and activator of transcription (STAT) Inducable Element (SIE) located at -679 kb. Our studies showed ErbB2 overexpressing cells had increased activated levels of STAT3, and therefore we hypothesized that STAT3 is responsible for the upregulation of the p21Cip1 promoter by ErbB2. EMSA and ChIP assays confirmed the binding of STAT3 to the p21Cip1 promoter and luciferase assays showed higher p21 Cip1 promoter activity in ErbB2 over-expressing transfectants when compared to parental cells, in a STAT3 binding site dependant manner. Additionally, reduced level of STAT3 led to reduced p21Cip1 protein expression and promoter activity indicating that both the STAT3 binding site and STAT3 protein are required for ErbB2-mediated p21Cip1 upregulation. Further investigation of ErbB2 downstream signaling showed increased Src kinase activity in ErbB2 over-expressing cells which was required for ErbB2-mediated STAT3 activation and p21Cip1 increase. Treatment of ErbB2 over-expressing resistant cells with STAT3 inhibitor peptides sensitized the cells to Taxol. In addition to classical signal transduction pathways, I identified a novel ErbB2 mediated regulatory mechanism of p21Cip1. I found that a nuclear ErbB2 and STAT3 complex binds directly to the p21Cip1 promoter offering a non-classical mechanism of p21Cip1 promoter regulation. These data suggest that ErbB2 over-expression can confer Taxol resistance of breast cancer cells by transcriptional upregulation of p21 Cip1 via activation of STAT3 by Src kinase and also by cooperation with nuclear ErbB2. The data suggest a potential clinical mechanism for STAT3 inhibitors in sensitizing ErbB2 over-expressing breast cancers to Taxol. ^

14-3-3 ZETA OVEREXPRESSION SERVES AS A NOVEL MOLECULAR SWITCH TURNING TGF-BETA FROM TUMOR SUPPRESSOR TO TUMOR PROMOTER

TGF-β plays an important role in differentiation and tissue morphogenesis as well as cancer progression. However, the role of TGF-β in cancer is complicate. TGF-β has primarily been recognized as tumor suppressor, because it can directly inhibit cell proliferation of normal and premalignant epithelial cell. However, in the last stage of tumor progression, TGF-β functions as tumor promoter to enhance tumor cells metastatic dissemination and expands metastatic colonies. Currently, the mechanism of how TGF-β switches its role from tumor suppressor to promoter still remains elusive. Here we identify that overexpression of 14-3-3ζ inhibits TGF-β’s cell cytostatic program through destabilizing p53 in non-transformed human mammary epithelial cells. Mechanistically, we found that 14-3-3ζ overexpression leads to 14-3-3σ downregulation, thereby activates PI3K/Akt signaling pathway and degrades p53, and further inhibits TGF-β induced p21 expression and cell cytostatic function. In addition, we found that overexpression of 14-3-3ζ promotes TGF-β induced breast cancer cells bone metastatic colonization through stabilizing Gli2, which is an important co-transcriptional factor for p-smad2 to activate PTHrP expression and bone osteolytic effect. Taken together, we reveal a novel mechanism that 14-3-3ζ dictates the tumor suppressor or metastases promoter activities of TGF-β signaling pathway through switching p-smad2 binding partner from p53 to Gli2. The expected results will not only provide us the better understanding of the important role of 14-3-3ζ in the early stage of breast cancer development, but also deeply impact our knowledge of signaling mechanisms underlying the complex roles of TGF-β in cancer, which will give us a more accurate strategy to determine when and how anti-TGF-β targeted therapy might be effective.

The effects of DNA cytosine methylation on H -ras promoter structure and function

The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^

Cloning and characterization of the full length cDNA and promoter of mouse tissue transglutaminase

Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^

Minimal DNA sequences that control the cell lineage-specific expression of the pro$\alpha$2(I) collagen promoter in transgenic mice

The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Characterization of the cholesterol 7$\alpha$-hydroxylase promoter in hypercholesterolemia -resistant rabbits

Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^

A distinct element involved in the lipopolysaccharide activation of the tumor necrosis factor -alpha promoter in a promonocytic cell line, THP-1

TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^