EXPRESSION OF THE HUMAN PLACENTAL LACTOGEN GENES

The placenta is the site of synthesis of various peptide and steroid hormones related to pregnancy. Human placental lactogen (hPL) is the predominant peptide hormone secreted by term placenta and its synthesis is tissue-specific and coupled to placenta development. The objective of this work was to study the structure and expression of the hPL.^ Poly(A('+))RNA from human term placenta was translated in a mouse-derived cell-free system. A major band corresponding to pre-hPL and a minor band comigrating with mature hPL, represent (TURN)15% of the total radioactively labeled proteins. Analysis of the poly(A('+))RNA showed a prominent band at approximately 860 nucleotides. A corresponding band was observed in Northern blots of total RNA, hybridized with {('32)P}-labeled recombinant plasmid containing a portion of hPL cDNA. Similar analyses of nuclear RNA showed at least four additional bands at 990, 1200, 1460 and 1760 nucleotides, respectively, which are likely precursors of hPL mRNA. Poly(A('+))RNA was used to construct a cDNA library, of which approximately 5% of the clones were found to hybridize to hPL DNA sequences. Heteroduplexes constructed between a clone containing a 815 bp hPL cDNA insert and a hPL genomic DNA clone revealed four small intervening sequences which can account for the lengths observed in hnRNA molecules.^ Recombinant plasmid HCS-pBR322 containing a 550 bp insert of a cDNA transcript of human placental lactogen (hPL) mRNA was ('3)H-labeled an hybridized in situ to human chromosome preparations. These experiments allowed assignment of the hPL and growth hormone (hGH) genes, which have over 90% nucleotide homology in their coding sequences, to band q22-24 of chromosome 17. A gene copy number experiment showed that both genes are present in (TURN)3 copies per haploid genome.^ Experiments were designed to determine if all members of the hPL gene cluster, consisting of four non-allelic genes, are transcribed in term placenta. Advantage was taken of differences in restriction endonuclease sites in the coding portions of the different hPL genes, to distinguish the putative cDNAs of the transcriptionally active genes. Two genes were found to be represented in the cDNA library and their cDNA transcripts were isolated and characterized. Three independent methods showed that their corresponding mRNAs are about equally represented in the hPL mRNA population. The two cDNAs code for prehPL proteins which differ at a single amino acid position. However the secreted hPLs have identical amino acid sequences. A tetramer insertion duplication was found in a palindrome area of the 3' untranslated region of one of the hPL mRNAs. ^

An analysis of the function of region 1.2 of the primary sigma factor, sigma 70, from Escherichia coli

The sigma (σ) subunit of eubacterial RNA polymerase is required for recognition of and transcription initiation from promoter DNA sequences. One family of sigma factors includes those related to the primary sigma factor from E. coli, σ70. Members of the σ70 family have four highly conserved domains, of which regions 2 through 4 are present in all members. Region 1 can be subdivided into regions 1.1 and 1.2. Region 1.1 affects DNA binding by σ 70 alone, as well as transcription initiation by holoenzyme. Region 1.2, present and highly conserved in most sigma factors, has not yet been assigned a putative function, although previous work demonstrated that it is not required for either association with the core subunits of RNA polymerase or promoter specific binding by holoenzyme. This study primarily investigates the functional role of region 1.2 during transcription initiation. In vivo and in vitro characterization of thirty-two single amino acid substitutions targeted to region 1.2 of E. coli σ70 as well as a deletion of region 1.2, revealed that mutations in region 1.2 can affect promoter binding, open complex formation, initiated complex formation, and the transition from abortive transcription to elongation. The relative degree of solvent exposure of several positions in region 1.2 has been determined, with positions 116 and 122 likely to be located near the surface of σ70. ^ During the course of this study, the existence of two “wild type” variants of E. coli σ70 was discovered. The identity of amino acid 149 has been reported variably as either arginine or aspartic acid in published articles and in online databases. In vivo and in vitro characterization of the two reported variations of E. coli σ70 (N149 and D149) has determined that the two variants are functionally equivalent. However, in vivo and in vitro characterization of single amino acid substitutions and a region 1.2 deletion in the context of each variant background revealed that the behavior of some mutations are greatly affected by the identity of amino acid 149. ^

Targeted Deletion Of Functionally Validated Enhancers Defines Their Role in Mouse Limb Development

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Molecular analysis of a neurovirulent murine leukemia virus, {\it ts\/}1

ts1 is a neurovirulent spontaneous temperature-sensitive mutant of Moloney murine leukemia virus TB (MoMuLV-TB). MoMuLV-TB causes T-cell lymphoma or lymphoid leukemia in mice after a long latency period whereas ts1 causes a progressive hindlimb paralytic disease after a much shorter latency period. In previous studies, it had been shown that the temperature-sensitive defect resided in the $env$ gene. At the restrictive temperature, the envelope precursor polyprotein, gPr80$\sp{env}$, is inefficiently processed intracellularly into a heterodimer consisting of two cleavage products, gp70 and Prp15E. This inefficient processing is correlated with neurovirulence. In this study, the nucleotide sequences of the env genes for both ts1 and MoMuLV-TB were determined, and the encoded amino acid sequences were deduced from the DNA sequences. There were four unique amino acid substitutions in the gPr80$\sp{env}$ of ts1. In order to determine which unique amino acid was responsible for the phenotypic characteristics of ts1, a set of hybrid genomes was constructed by exchanging restriction fragments between ts1 and MoMuLV-TB. NIH 3T3 cells were transfected with the hybrid genomes to obtain infectious hybrid viruses. Assays of the hybrid viruses showed that a Val-25$\to$Ile substitution in gPr80$\sp{env}$ was responsible for the temperature sensitivity, inefficient processing, and neurovirulence of ts1. In further studies, the Ile-25 in gPr80$\sp{env}$ was substituted with Thr, Ala, Leu, Gly, and Glu by site-directed mutagenesis to generate a new set of mutant viruses, i.e., ts1-T, -A, -L, -G, and -E, respectively. The rank order of the mutants for temperature sensitivity was: ts1-E $>$ ts1-G $>$ ts1-L $>$ ts1-A $>$ ts1 $>$ ts1-T. The degree of temperature sensitivity of each of the mutants also correlated with the degree of inefficient processing of gPr80$\sp{env}$. The mutant viruses were assayed for neurovirulence. ts1-T caused whole body tremor, ts1-A caused hindlimb paralysis, ts1-L caused paraparesis, but ts1-G and -E were not neurovirulent. These results show that inefficient processing of gPr80$\sp{env}$ is correlated with neurovirulence, but if processing of gPr80$\sp{env}$ is too inefficient there is no neurovirulence. Furthermore, the disease profile of each of the neurovirulent viruses depends on the degree of inefficient processing of gPr80$\sp{env}$. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

2-methylthio-N$\sp6$-dimethylallyl modification of adenosine 37 of tRNAs in {\it Escherichia coli\/} K-12

The hypermodified, hydrophobic 2-methylthio-N$\sp6$-(dimethylallyl)-adenosine (ms${2{\cdot}6}\atop1$A) residue occurs $3\sp\prime$ to the anticodon in tRNA species that read codons beginning with U. The first step (i$\sp6$A37 formation) of this modification is catalyzed by dimethylallyl diphosphate:tRNA dimethyallyltransferase (EC 2.5.1.8), which is the product of the miaA gene. Subsequent steps were proposed to be catalyzed by MiaB and MiaC enzymes to complete the ms${2{\cdot}6}\atop1$A37 modification. The study of functions of the ms${2{\cdot}6}\atop1$A37 is very important because this modified base is one of the best candidates for a role in global control in response to environmental stress. This dissertation describes the further delineation of functions of the ms${2{\cdot}6}\atop1$A37 modification in E. coli K-12 cells. This work provides significant information on functions of tRNA modifications in E. coli cells to adapt to stressful environmental conditions. Three hypotheses were tested in this work.^ The first hypothesis tested was that non-optimal translation processes cause increased spontaneous mutagenesis by the induction of SOS response in starving cells. To test this hypothesis, I measured spontaneous mutation rates of wild type cells and various mutant strains which are defective in tRNA modification, SOS response, or oxidative damage repair. I found that the miaA mutation acts as a mutator that increased Lac$\sp+$ reversion rates and Trp$\sp+$ reversion frequencies of the wild-type cells in starving conditions. However, the lexA3(Ind)(which abolishes the induction of SOS response) mutation abolished the mutator phenotype of the miaA mutant. The recA430 mutation, not other identified SOS genes, decreased the Lac$\sp+$ reversion to a less extent than that of the lexA3(Ind) mutation. These results suggest that RecA together with another unidentified SOS gene product are responsible for the process.^ The second hypothesis tested was that MiaA protein binds to full-length tRNA$\sp{\rm Phe}$ molecules in form of a protein dimer. To test this hypothesis, three versions of the MiaA protein and seven species of tRNA substrates were purified. Binding studies by gel mobility shift assays, filter binding assays and gel filtration shift assays support the hypothesis that MiaA protein binds to full-length tRNA$\sp{\rm Phe}$ as a protein dimer but as a monomer to the anticodon stem-and-loop. These results were further supported by using steady state enzyme kinetic studies.^ The third hypothesis tested in this work was that the miaB gene in E. coli exists and is clonable. The miaB::Tn10dCm insertion mutation of Salmonella typhimurium was transduced to E. coli K-12 cells by using P$\sb1$ and P$\sb{22}$ bacteriophages. The insertion was confirmed by HPLC analyses of nucleotide profiles of miaB mutants of E. coli. The insertion mutation was cloned and DNA sequences adjacent to the transposon were sequenced. These DNA sequences were 86% identical to the f474 gene at 14.97 min chromosome of E. coli. The f474 gene was then cloned by PCR from the wild-type chromosome of E. coli. The recombinant plasmid complemented the mutant phenotype of the miaB mutant of E. coli. These results support the hypothesis that the miaB gene of E. coli exists and is clonable. In summary, functions of the ms${2{\cdot}6}\atop1$A37 modification in E. coli cells are further delineated in this work in perspectives of adaptation to stressful environmental conditions and protein:tRNA interaction. (Abstract shortened by UMI.) ^

VERIFICATION OF DNA PREDICTED PROTEIN SEQUENCES BY ENZYME HYDROLYSIS AND MASS SPECTROMETRIC ANALYSIS

The focus of this thesis lies in the development of a sensitive method for the analysis of protein primary structure which can be easily used to confirm the DNA sequence of a protein's gene and determine the modifications which are made after translation. This technique involves the use of dipeptidyl aminopeptidase (DAP) and dipeptidyl carboxypeptidase (DCP) to hydrolyze the protein and the mass spectrometric analysis of the dipeptide products.^ Dipeptidyl carboxypeptidase was purified from human lung tissue and characterized with respect to its proteolytic activity. The results showed that the enzyme has a relatively unrestricted specificity, making it useful for the analysis of the C-terminal of proteins. Most of the dipeptide products were identified using gas chromatography/mass spectrometry (GC/MS). In order to analyze the peptides not hydrolyzed by DCP and DAP, as well as the dipeptides not identified by GC/MS, a FAB ion source was installed on a quadrupole mass spectrometer and its performance evaluated with a variety of compounds.^ Using these techniques, the sequences of the N-terminal and C-terminal regions and seven fragments of bacteriophage P22 tail protein have been verified. All of the dipeptides identified in these analysis were in the same DNA reading frame, thus ruling out the possibility of a single base being inserted or deleted from the DNA sequence. The verification of small sequences throughout the protein sequence also indicates that no large portions of the protein have been removed after translation. ^

DNA incisions stimulate genetic instability of triplet repeat sequences related to human hereditary neurological diseases

The molecular mechanisms responsible for the expansion and deletion of trinucleotide repeat sequences (TRS) are the focus of our studies. Several hereditary neurological diseases including Huntington's disease, myotonic dystrophy, and fragile X syndrome are associated with the instability of TRS. Using the well defined and controllable model system of Escherichia coli, the influences of three types of DNA incisions on genetic instability of CTG•CAG repeats were studied: DNA double-strand breaks (DSB), single-strand nicks, and single-strand gaps. The DNA incisions were generated in pUC19 derivatives by in vitro cleavage with restriction endonucleases. The cleaved DNA was then transformed into E. coli parental and mutant strains. Double-strand breaks induced deletions throughout the TRS region in an orientation dependent manner relative to the origin of replication. The extent of instability was enhanced by the repeat length and sequence (CTG•CAG vs. CGG•CCG). Mutations in recA and recBC increased deletions, mutations in recF stabilized the TRS, whereas mutations in ruvA had no effect. DSB were repaired by intramolecular recombination, versus an intermolecular gene conversion or crossover mechanism. 30 nt gaps formed a distinct 30 nt deletion product, whereas single strand nicks and gaps of 15 nts did not induce expansions or deletions. Formation of this deletion product required the CTG•CAG repeats to be present in the single-stranded region and was stimulated by E. coli DNA ligase, but was not dependent upon the RecFOR pathway. Models are presented to explain the DSB induced instabilities and formation of the 30 nucleotide deletion product. In addition to the in vitro creation of DSBs, several attempts to generate this incision in vivo with the use of EcoR I restriction modification systems were conducted. ^

Non B-DNA structures and genomic instability associated with myotonic dystrophy type 2 (CCTG).(CAGG) repeats

There are many diseases associated with the expansion of DNA repeats in humans. Myotonic dystrophy type 2 is one of such diseases, characterized by expansions of a (CCTG)•(CAGG) repeat tract in intron 1 of zinc finger protein 9 (ZNF9) in chromosome 3q21.3. The DM2 repeat tract contains a flanking region 5' to the tract that consists of a polymorphic repetitive sequence (TG)14-25(TCTG)4-11(CCTG) n. The (CCTG)•(CAGG) repeat is typically 11-26 repeats in persons without the disease, but can expand up to 11,000 repeats in affected individuals, which is the largest expansion seen in DNA repeat diseases to date. This DNA tract remains one of the least characterized disease-associated DNA repeats, and mechanisms causing the repeat expansion in humans have yet to be elucidated. Alternative, non B-DNA structures formed by the expanded repeats are typical in DNA repeat expansion diseases. These sequences may promote instability of the repeat tracts. I determined that slipped strand structure formation occurs for (CCTG)•(CAGG) repeats at a length of 42 or more. In addition, Z-DNA structure forms in the flanking human sequence adjacent to the (CCTG)•(CAGG) repeat tract. I have also performed genetic assays in E. coli cells and results indicate that the (CCTG)•(CAGG) repeats are more similar to the highly unstable (CTG)•(CAG) repeat tracts seen in Huntington's disease and myotonic dystrophy type 1, than to those of the more stable (ATTCT)•(AGAAT) repeat tracts of spinocerebellar ataxia type 10. This instability, however, is RecA-independent in the (CCTG)•(CAGG) and (ATTCT)•(AGAAT) repeats, whereas the instability is RecA-dependent in the (CTG)•(CAG) repeats. Structural studies of the (CCTG)•(CAGG) repeat tract and the flanking sequence, as well as genetic selection assays may reveal the mechanisms responsible for the repeat instability in E. coli, and this may lead to a better understanding of the mechanisms contributing to the human disease state. ^