30 resultados para PROMOTER POLYMORPHISM
Resumo:
DNA sequence variation is currently a major source of data for studying human origins, evolution, and demographic history, and for detecting linkage association of complex diseases. In this dissertation, I investigated DNA variation in worldwide populations from two ∼10 kb autosomal regions on 22q11.2 (noncoding) and 1q24 (introns). A total of 75 variant sites were found among 128 human sequences in the 22q11.2 region, yielding an estimate of 0.088% for nucleotide diversity (π), and a total of 52 variant sites were found among 122 human sequences in the 1q24 region with an estimated π value of 0.057%. The data from these two regions and a 10 kb noncoding region on Xq13.3 all show a strong excess of low-frequency variants in comparison to that expected from an equilibrium population, indicating a relatively recent population expansion. The effective population sizes estimated from the three regions were 11,000, 12,700, and 8,600, respectively, which are close to the commonly used value of 10,000. In each of the two autosomal regions, the age of the most recent common ancestor (MRCA) was estimated to be older than 1 million years among all the sequences and ∼600,000 years among non-African sequences, providing first evidence from autosomal noncoding or intronic regions for a genetic history of humans much more ancient than the emergence of modern humans. The ancient genetic history of humans indicates no severe bottleneck during the evolution of humans in the last half million years; otherwise, much of the ancient genetic history would have been lost during a severe bottleneck. This study strongly suggests that both the “out of Africa” and the multiregional models are too simple for explaining the evolution of modern humans. A compilation of genome-wide data revealed that nucleotide diversity is highest in autosomal regions, intermediate in X-linked regions, and lowest in Y-linked regions. The data suggest the existence of background selection or selective sweep on Y-linked loci. In general, the nucleotide diversity in humans is low compared to that in chimpanzee and Drosophila populations. ^
Resumo:
With hundreds of single nucleotide polymorphisms (SNPs) in a candidate gene and millions of SNPs across the genome, selecting an informative subset of SNPs to maximize the ability to detect genotype-phenotype association is of great interest and importance. In addition, with a large number of SNPs, analytic methods are needed that allow investigators to control the false positive rate resulting from large numbers of SNP genotype-phenotype analyses. This dissertation uses simulated data to explore methods for selecting SNPs for genotype-phenotype association studies. I examined the pattern of linkage disequilibrium (LD) across a candidate gene region and used this pattern to aid in localizing a disease-influencing mutation. The results indicate that the r2 measure of linkage disequilibrium is preferred over the common D′ measure for use in genotype-phenotype association studies. Using step-wise linear regression, the best predictor of the quantitative trait was not usually the single functional mutation. Rather it was a SNP that was in high linkage disequilibrium with the functional mutation. Next, I compared three strategies for selecting SNPs for application to phenotype association studies: based on measures of linkage disequilibrium, based on a measure of haplotype diversity, and random selection. The results demonstrate that SNPs selected based on maximum haplotype diversity are more informative and yield higher power than randomly selected SNPs or SNPs selected based on low pair-wise LD. The data also indicate that for genes with small contribution to the phenotype, it is more prudent for investigators to increase their sample size than to continuously increase the number of SNPs in order to improve statistical power. When typing large numbers of SNPs, researchers are faced with the challenge of utilizing an appropriate statistical method that controls the type I error rate while maintaining adequate power. We show that an empirical genotype based multi-locus global test that uses permutation testing to investigate the null distribution of the maximum test statistic maintains a desired overall type I error rate while not overly sacrificing statistical power. The results also show that when the penetrance model is simple the multi-locus global test does as well or better than the haplotype analysis. However, for more complex models, haplotype analyses offer advantages. The results of this dissertation will be of utility to human geneticists designing large-scale multi-locus genotype-phenotype association studies. ^
Resumo:
Although tobacco exposure remains the prevailing risk factor for bladder cancer (BC), only a small percentage of exposed individuals develop cancer, suggesting that tobacco-related carcinogenesis is modulated by genetic susceptibility and possibly by DNA methylation-related events. Methylation patterns established by DNA methyltransferases (DNMTs) are influenced by dietary folate and genetic polymorphisms in the methylene-tetrahydrofolate reductase gene (MTHFR). Therefore, we hypothesized that DNA methylation-related genes, such as DNMT3B and MTHFR, might modulate BC risk. ^ In a study of 514 Caucasian BC cases and 498 healthy Caucasian controls examining the DNMT3B C46359T polymorphism, CC genotype was found to be a risk factor in women (Odds Ratio (OR) = 1.79), but not in men. This risk was further increased among women who were never smokers, consumed low dietary folate, and had adverse variants of MTHFR. In addition, higher DNMT3B expression among smokers was a risk factor (OR = 4.27) and correlated with genetic variants of the DNMT3B C46359T polymorphism, providing salient evidence for the risk associated with the CC variant. This suggests that the DNMT3B CC variant may confer a predisposition toward aberrant de novo methylation of CpG islands in critical tumor suppressor genes. ^ The convergence of alterations in DNMT3B, associated with promoter methylation, and reduced dietary folate consumption, accompanying global hypomethylation and genetic instability, may act synergistically to promote bladder carcinogenesis, especially in women. The results of this study unveiled new gender-specific paradigms of BC risk for women and demonstrated that this risk can be modified by folate consumption as well as polymorphisms in the folate pathway. ^
Resumo:
Over-expression of the receptor tyrosine kinase ErbB2 is prevalent in approximately 30% of human breast carcinomas and confers Taxol resistance. In breast cancer cells, Taxol induces tubulin polymerization and hyperstable microtubule formation. This in turn prematurely activates Cdc2 kinase allowing early entry into the G2/M phase of the cell cycle resultant in mitotic catastrophe followed by apoptosis. Over-expression of ErbB2 upregulates p21Cip1, which inhibits Cdc2 activation, and leads to Taxol resistance in patients. However, the mechanism of ErbB2-mediated p21 Cip1 upregulation is unclear. Here in this study, we investigated the mechanism of ErbB2 downstream signaling events leading to upregulation. The CDKN1A (p21Cip1) gene promoter contains numerous cis-elements including a Signal transducer and activator of transcription (STAT) Inducable Element (SIE) located at -679 kb. Our studies showed ErbB2 overexpressing cells had increased activated levels of STAT3, and therefore we hypothesized that STAT3 is responsible for the upregulation of the p21Cip1 promoter by ErbB2. EMSA and ChIP assays confirmed the binding of STAT3 to the p21Cip1 promoter and luciferase assays showed higher p21 Cip1 promoter activity in ErbB2 over-expressing transfectants when compared to parental cells, in a STAT3 binding site dependant manner. Additionally, reduced level of STAT3 led to reduced p21Cip1 protein expression and promoter activity indicating that both the STAT3 binding site and STAT3 protein are required for ErbB2-mediated p21Cip1 upregulation. Further investigation of ErbB2 downstream signaling showed increased Src kinase activity in ErbB2 over-expressing cells which was required for ErbB2-mediated STAT3 activation and p21Cip1 increase. Treatment of ErbB2 over-expressing resistant cells with STAT3 inhibitor peptides sensitized the cells to Taxol. In addition to classical signal transduction pathways, I identified a novel ErbB2 mediated regulatory mechanism of p21Cip1. I found that a nuclear ErbB2 and STAT3 complex binds directly to the p21Cip1 promoter offering a non-classical mechanism of p21Cip1 promoter regulation. These data suggest that ErbB2 over-expression can confer Taxol resistance of breast cancer cells by transcriptional upregulation of p21 Cip1 via activation of STAT3 by Src kinase and also by cooperation with nuclear ErbB2. The data suggest a potential clinical mechanism for STAT3 inhibitors in sensitizing ErbB2 over-expressing breast cancers to Taxol. ^
Resumo:
Alternate splicing of the cyclin D1 gene gives rise to transcript a and b which encode two protein isoforms cyclin D1a and cyclin D1b. Through testing transcript a and transcript b in a series of human samples, we found that cyclin D1 transcript b is ubiquitously expressed as transcript a but in the lower abundance compared to transcript a. Epidemiological studies have reported that the cyclin D1 gene (CCND1) G870A polymorphism influences the risk for a variety of cancer. In this investigation, we examined the cyclin D1b levels in tumor samples with different genotypes and found that higher levels of cyclin D1b are expressed from the A allele than the G allele. Cyclin D1 is known as a cell cycle regulator facilitating the progression of the cell cycle from G1 to S phase in response to the mitogenic signals. It also interacts with several transcription factors and transcriptional coregulators to modulate their activities. It has been reported that cyclin D1a can substitute for estrogen to activate estrogen receptor α (ERα) mediated transcription and can induce the proliferation of estrogen responsive tissues. However the biological role of cyclin D1b in ERα transcriptional regulation has not been previously explored. In this study, we determined that cyclin D1b antagonizes the action of cyclin D1a on ERα mediated transcription. Cell proliferation assays provided the evidence that cyclin D1b negatively regulates estrogen responsive breast cancer cell growth. Taken together, our findings show that the CCND1 G870A polymorphism is correlated with increased levels of cyclin D1b and that cyclin D1b antagonizes the action of cyclin D1a on ERα mediated transcription providing evidence for the mechanism by which the CCND1 G870A polymorphism may be protective in certain types of breast cancer. ^
Resumo:
The overall purpose of this study was to assess the relationship between the promoter region polymorphism (-2607 1G/2G) of matrix metalloproteinase-1 (MMP-1) polymorphism and outcome in brain tumor patients diagnosed with a primary brain tumor between 1994 and 2000 at The University of Texas M. D. Anderson Cancer Center. The MMP-1 polymorphism was genotyped for all brain tumor patients who participated in the Family Brain Tumor Study and for whom blood samples were available. Relevant covariates were abstracted from medical records for all cases from the original protocol, including information on demographics, tumor histology, therapy and outcome was obtained. The hypothesis was that brain tumor patients with the 2G allele have a poorer prognosis and shorter survival than brain tumor patients with the 1G allele. ^ Experimental Design: Genetic variants for the MMP-1 enzyme were determined by a polymerase chain reaction-restriction fragment length polymorphism assay. Comparison was made between the overall survival for cases with the 2G polymorphism and overall survival for cases with the 1G polymorphism using multivariable Cox Proportional-Hazard analysis, controlling for age, sex, Karnofsky Performance Scale (KPS), extent of surgery, tumor histology and treatment received. Kaplan-Meier and Cox Proportional-Hazard analyses were utilized to assess if the MMP-1 polymorphisms were related to overall survival. Results: Overall survival was not statistically significantly different between the 2G allele brain tumor patients and the 1G allele patients and there was no statistically significant difference between tumor types. ^ Conclusions: No association was found between MMP-1 polymorphisms and survival in patients with malignant gliomas. ^
Resumo:
Two molecular epidemiological studies were conducted to examine associations between genetic variation and risk of squamous cell carcinoma of the head and neck (SCCHN). In the first study, we hypothesized that genetic variation in p53 response elements (REs) may play roles in the etiology of SCCHN. We selected and genotyped five polymorphic p53 REs as well as a most frequently studied p53 codon 72 (Arg72Pro, rs1042522) polymorphism in 1,100 non-Hispanic White SCCHN patients and 1,122 age-and sex-matched cancer-free controls recruited at The University of Texas M. D. Anderson Cancer Center. In multivariate logistic regression analysis with adjustment for age, sex, smoking and drinking status, marital status and education level, we observed that the EOMES rs3806624 CC genotype had a significant effect of protection against SCCHN risk (adjusted odds ratio= 0.79, 95% confidence interval =0.64–0.98), compared with the -838TT+CT genotypes. Moreover, a significantly increased risk associated with the combined genotypes of p53 codon 72CC and EOMES -838TT+CT was observed, especially in the subgroup of non-oropharyneal cancer patients. The values of false-positive report probability were also calculated for significant findings. In the second study, we assessed the association between SCCHN risk and four potential regulatory single nucleotide polymorphisms (SNPs) of DEC1 (deleted in esophageal cancer 1) gene, a candidate tumor suppressor gene for esophageal cancer. After adjustment for age, sex, and smoking and drinking status, the variant -606CC (i.e., -249CC) homozygotes had a significantly reduced SCCHN risk (adjusted odds ratio = 0.71, 95% confidence interval = 0.52–0.99), compared with the -606TT homozygotes. Stratification analyses showed that a reduced risk associated with the -606CC genotype was more pronounced in subgroups of non-smokers, non-drinkers, younger subjects (defined as ≤ 57 years), carriers of TP53 Arg/Arg (rs1042522) genotype, patients with oropharyngeal cancer or late-stage SCCHN. Further in silico analysis revealed that the -249 T-to-C change led to a gain of a transcription factor binding site. Additional functional analysis showed that the -249T-to-C change significantly enhanced transcriptional activity of the DEC1 promoter and the DNA-protein binding activity. We conclude that the DEC1 promoter -249 T>C (rs2012775) polymorphism is functional, modulating susceptibility to SCCHN among non-Hispanic Whites. Additional large-scale, preferably population-based studies are needed to validate our findings.^
Resumo:
TGF-β plays an important role in differentiation and tissue morphogenesis as well as cancer progression. However, the role of TGF-β in cancer is complicate. TGF-β has primarily been recognized as tumor suppressor, because it can directly inhibit cell proliferation of normal and premalignant epithelial cell. However, in the last stage of tumor progression, TGF-β functions as tumor promoter to enhance tumor cells metastatic dissemination and expands metastatic colonies. Currently, the mechanism of how TGF-β switches its role from tumor suppressor to promoter still remains elusive. Here we identify that overexpression of 14-3-3ζ inhibits TGF-β’s cell cytostatic program through destabilizing p53 in non-transformed human mammary epithelial cells. Mechanistically, we found that 14-3-3ζ overexpression leads to 14-3-3σ downregulation, thereby activates PI3K/Akt signaling pathway and degrades p53, and further inhibits TGF-β induced p21 expression and cell cytostatic function. In addition, we found that overexpression of 14-3-3ζ promotes TGF-β induced breast cancer cells bone metastatic colonization through stabilizing Gli2, which is an important co-transcriptional factor for p-smad2 to activate PTHrP expression and bone osteolytic effect. Taken together, we reveal a novel mechanism that 14-3-3ζ dictates the tumor suppressor or metastases promoter activities of TGF-β signaling pathway through switching p-smad2 binding partner from p53 to Gli2. The expected results will not only provide us the better understanding of the important role of 14-3-3ζ in the early stage of breast cancer development, but also deeply impact our knowledge of signaling mechanisms underlying the complex roles of TGF-β in cancer, which will give us a more accurate strategy to determine when and how anti-TGF-β targeted therapy might be effective.
Resumo:
The incidence of OSCC in younger population and in those who never smoked or drank has increased since the last decade. This increase may be attributable to increase of infection with HPV. The pro-inflammatory cytokine TNF-&agr; has the role in the pathogenesis of chronic inflammatory diseases and was found to control HPV infection in cervical cancer studies. Our study aimed to investigate the association between the four polymorphisms located in TNF-&agr; promoter region, -308(rs1800629), -857(rs1799724), -863(rs1800630) and -1031(rs1799964), and the risk of HPV-related OSCC. In this hospital-based case-control study, 325 cases and 335 controls were included. We found that HPV 16 seropositivity was associated with an increased risk of oral cancer (OR = 3.1, 95% CI, 2.1–4.6). Each of the polymorphism showed to increase the risk of HPV-related OSCC. And after combining the risk genotypes and using the low-risk group (0–1 combined risk genotypes) and HPV16 seronegativity as the reference group, only the high-risk groups (3–4 combined risk genotypes) and HPV16 seronegativity were associated with a low OR of 1.8 (95% CI, 1.1–2.8), while the low-risk and high-risk groups and HPV16 seropositivity were significantly associated with a higher OR of 2.7 (95% CI, 1.3–5.8) and 8.5 (95% CI, 3.7–19.4), respectively. In addition, the joint effects were greater among the young subjects (aged<50), males, never smokers or never drinkers, and patients with oropharyngeal cancer. Overall, the four TNF-&agr; polymorphisms, individually or collectively, would result in a significantly increased risk for HPV16-associated oral cancer in a non-Hispanic white population. More large sized studies are needed for future investigation.^
Resumo:
The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^
Resumo:
Transglutaminases are a family of enzymes that catalyze the covalent cross-linking of proteins through the formation of $\varepsilon$-($\gamma$-glutaminyl)-lysyl isopeptide bonds. Tissue transglutaminase (Tgase) is an intracellular enzyme which is expressed in terminally differentiated and senescent cells and also in cells undergoing apoptotic cell death. To characterize this enzyme and examine its relationship with other members of the transglutaminase family, cDNAs, the first two exons of the gene and 2 kb of the 5$\sp\prime$ flanking region, including the promoter, were isolated. The full length Tgase transcript consists of 66 bp of 5$\sp\prime$-UTR (untranslated) sequence, an open reading frame which encodes 686 amino acids and 1400 bp of 3$\sp\prime$-UTR sequence. Alignment of the deduced Tgase protein sequence with that of other transglutaminases revealed regions of strong homology, particularly in the active site region.^ The Tgase cDNA was used to isolate and characterize a genomic clone encompassing the 5$\sp\prime$ end of the mouse Tgase gene. The transcription start site was defined using genomic and cDNA clones coupled with S1 protection analysis and anchored PCR. This clone includes 2.3 kb upstream of the transcription start site and two exons that contain the first 256 nucleotides of the mouse Tgase cDNA sequence. The exon intron boundaries have been mapped and compared with the exon intron boundaries of three members of the transglutaminase family: human factor XIIIa, the human keratinocyte transglutaminase and human erythrocyte band 4.1. Tissue Tgase exon II is similar to comparable exons of these genes. However, exon I bears no resemblance with any of the other transglutaminase amino terminus exons.^ Previous work in our laboratory has shown that the transcription of the Tgase gene is directly controlled by retinoic acid and retinoic acid receptors. To identify the region of the Tgase gene responsible for regulating its expression, fragments of the Tgase promoter and 5$\sp\prime$-flanking region were cloned into the chloramphenicol actetyl transferase (CAT) reporter constructs. Transient transfection experiments with these constructs demonstrated that the upstream region of Tgase is a functional promoter which contains a retinoid response element within a 1573 nucleotide region spanning nucleotides $-$252 to $-$1825. ^
Resumo:
The pattern of expression of the pro$\alpha$2(I) collagen gene is highly tissue-specific in adult mice and shows its strongest expression in bones, tendons, and skin. Transgenic mice were generated harboring promoter fragments of the mouse pro$\alpha$2(I) collagen gene linked to the Escherichia coli $\beta$-galactosidase or firefly luciferase genes to examine the activity of these promoters during development. A region of the mouse pro$\alpha$2(I) collagen promoter between $-$2000 and +54 exhibited a pattern of $\beta$-galactosidase activity during embryonic development that corresponded to the expression pattern of the endogenous pro$\alpha$2(I) collagen gene as determined by in situ hybridization. A similar pattern of activity was also observed with much smaller promoter fragments containing either 500 or 350 bp of upstream sequence relative to the start of transcription. Embryonic regions expressing high levels of $\beta$-galactosidase activity included the valves of the developing heart, sclerotomes, meninges, limb buds, connective tissue fascia between muscle fibers, osteoblasts, tendon, periosteum, dermis, and peritoneal membranes. The pattern of $\beta$-galactosidase activity was similar to the extracellular immunohistochemical localization of transforming growth factor-$\beta$1 (TGF-$\beta$1). The $-$315 to $-$284 region of the pro$\alpha$2(I) collagen promoter was previously shown to mediate the stimulatory effects of TGF-$\beta$1 on the pro$\alpha$2(I) collagen promoter in DNA transfection experiments with cultured fibroblasts. A construct containing this sequence tandemly repeated 5$\sp\prime$ to both a very short $\alpha$2(I) collagen promoter ($-$40 to +54) and a heterologous minimal promoter showed preferential activity in tail and skin of 4-week old transgenic mice. The pattern of expression mimics that of the $-$350 to +54 pro$\alpha$2(I) collagen promoter linked to a luciferase reporter gene in transgenic mice. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Our laboratory has developed and partially characterized a strain of New Zealand white rabbits that are resistant to the hypercholesterolemia which typically occurs in normal rabbits when fed a cholesterol-enriched diet. This phenotype is most likely attributed to an increase in bile acid excretion by hypercholesterolemia-resistant (CRT) rabbits as a result of elevated enzyme activity of cholesterol 7$\alpha$-hydroxylase (C7$\alpha$H), the rate-limiting enzyme in bile acid synthesis. Northern analysis revealed that CRT rabbits, in comparison to normal rabbits, have a 7-fold greater steady-state C7$\alpha$H mRNA levels irrespective of dietary regimen. The C7$\alpha$H gene in both phenotypes was determined to be a single copy gene. The hypothesis was that the elevated C7$\alpha$H mRNA levels in CRT rabbits, in comparison to normal animals, was due to an increase in the transcription rate of the C7$\alpha$H gene as a result of a mutation in a cis-acting element and/or a trans-acting factor within the hepatocyte. To isolate the C7$\alpha$H gene from both normal and CRT rabbits, genomic libraries were prepared from both phenotypes into $\lambda$GEM12 vectors using conventional techniques. Three CRT and one normal phage clones that contained the C7$\alpha$H gene were identified by screening the library with a series of probes located within different exons of the C7$\alpha$H cDNA. Sequencing analysis confirmed that approximately 1100 bp of the C7$\alpha$H 5'-flanking region from both normal and CRT phenotypes was identical. The increase in C7$\alpha$H mRNA levels was not attributed to a cis-acting mutation within this region. Liver nuclear extracts were prepared from normal and CRT rabbits maintained either on a basal or 0.25% cholesterol-enriched diet and incubated with several radiolabeled DNA fragments from the C7$\alpha$H gene. A 37 basepair region, located between nucleotides $-$452 to $-$416 was identified that had altered binding patterns between normal and CRT rabbits as a function of diet. Two additional regions, $-$747 to $-$575 and $-$580 to $-$442, produced banding patterns which were identical, irrespective of phenotype or diet. In conclusion, these studies suggested that the increase in C7$\alpha$H mRNA in CRT rabbits was due to differences in binding of a cholesterol-responsive transcription factor to the C7$\alpha$H promoter. ^
Resumo:
TNF-α is a pleiotropic cytokine involved in normal homeostasis and plays a key role in defending the host from infection and malignancy. However when deregulated, TNF-α can lead to various disease states. Therefore, understanding the mechanisms by which TNF-α is regulated may aid in its control. In spite of the knowledge gained regarding the transcriptional regulation of TNF-α further characterization of specific TNF-α promoter elements remains to be elucidated. In particular, the T&barbelow;NF-α A&barbelow;P-1/C&barbelow;RE-like (TAC) element of the TNF-α promoter has been shown to be important in the regulation of TNF-α in lymphocytes. Activating transcription factor-2 (ATF-2) and c-Jun were shown to bind to and transactivate the TAC element However, the role of TAC and transcription factors ATF-2 and c-Jun in the regulation of TNF-α in monocytes is not as well characterized. Lipopolysaccharide (LPS), a potent activator of TNF-α in monocytes, provides a good model to study the involvement of TAC in TNF-α regulation. On the other hand, all-tram retinoic acid (ATRA), a physiological monocyte-differentiation agent, is unable to induce TNF-α protein release. ^ To delineate the functional role of TAC, we transfected the wildtype or the TAC deleted TNF-α promoter-CAT construct into THP-1 promonocytic cells before stimulating them with LPS. CAT activity was induced 17-fold with the wildtype TNF-α promoter, whereas the CAT activity was uninducible when the TAC deletion mutant was used. This daft suggests that TAC is vital for LPS to activate the TNF-α promoter. Electrophoretic mobility shift assays using the TAC element as a probe showed a unique pattern for LPS-activated cells: the disappearance of the upper band of a doublet seen in untreated and ATRA treated cells. Supershift analysis identified c-Jun and ATF-2 as components of the LPS-stimulated binding complex. Transient transfection studies using dominant negative mutants of JNK, c-Jun, or ATF-2 suggest that these proteins we important for LPS to activate the TNF-α promoter. Furthermore, an increase in phosphorylated or activated c-Jun was bound to the TAC element in LPS-stimulated cells. Increased c-Jun activation was correlated with increased activity of Jun N-terminal kinase (JNK), a known upstream stimulator of c-Jun and ATF-2, in LPS-stimulated monocytes. On the other hand, ATRA did not induce TNF-α protein release nor changes in the phosphorylation of c-Jun or JNK activity, suggesting that pathways leading to ATRA differentiation of monocytic cells are independent of TNF-α activation. Together, the induction of TNF-α gene expression seems to require JNK activation, and activated c-Jun binding to the TAC element of the TNF-α promoter in THP-1 promonocytic cells. ^