597 resultados para Bactérias
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Microbiologia Agropecuária - FCAV
Resumo:
Pós-graduação em Ciências Biológicas (Microbiologia Aplicada) - IBRC
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Agronomia (Proteção de Plantas) - FCA
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
The persistence of MCs in aquatic environments and their difficult removal in the conventional water treatment is a challenge to companies of sanitation. However, the MCs are susceptible to degradation by bacteria present in water, sediment and sewage effluents. In this study, we investigated the biodegradation of MCs by microorganism present in carbon filters with biological activity (BAC) and their phylogenetic identification by sequencing gene 16S RNA. A study of water containing MCs was used, with different compositions, plus a filters BAC effluent. The results showed that of MCs were biodegraded by microorganism present in the biofilm. This study provides the ability to complete biodegradation of MCs by bacteria present in BAC filters and the possible use of these microorganisms as alternative of the removal of MCs in the treatment of drinking water
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)