79 resultados para X-ray crystallography
em CentAUR: Central Archive University of Reading - UK
Resumo:
The oxalate oxidase enzyme expressed in barley roots is a thermostable, protease-resistant enzyme that generates H2O2. It has great medical importance because of its use to assay plasma and urinary oxalate, and it has also been used to generate transgenic, pathogen-resistant crops. This protein has now been purified and three types of crystals grown. X-ray analysis shows that the symmetry present in these crystals is consistent with a hexameric arrangement of subunits, probably a trimer of dimers. This structure may be similar to that found in the related seed storage proteins.
Resumo:
Two octahedral complexes [Ni(HL1)(2)](ClO4)(2) (1) and [Ni(HL2)(2)](ClO4)(2) (2) and a square planar complex [Ni(HL3)]ClO4 (3) have been prepared, where [HL1 = 3-(2-amino-ethylimino)-butan-2-one oxime, HL2 = 3-(2-amino-propylimino)butan-2-one oxime] and H2L3 = 3-[2-(3-hydroxy-1-methyl-but-2-enylideneamino)-1-methyl-ethylimino]-buta n-2-one oxime. All the complexes have been characterized by elemental analyses, spectral studies and room temperature magnetic moment measurements. The molecular structures of all three compounds were elucidated on the basis of X-ray crystallography: complexes 1 and 2 are seen to be the met isomers. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The lithium salt of the anionic SPS pincer ligand composed of a central hypervalent lambda(4)-phosphinine ring bearing two ortho-positioned diphenylphosphine sulfide side arms reacts with [Mn(CO)(5)Br] to give fac-[Mn(SPS)(CO)(3)], This isomer can be converted photochemicaily to mer-[Mn(SPS)(CO)(3)], with a very high quantum yield (0.80 +/- 0.05). The thermal backreaction is slow (taking ca. 8 h at room temperature), in contrast to rapid electrodecatalyzed mer-to-fac isomerization triggered by electrochemical reduction of mer-[Mn(SPS)(CO)(3)]. Both geometric isomers of [Mn(SPS)(CO)(3)] have been characterized by X-ray crystallography. Both isomers show luminescence from a low-lying (IL)-I-3 (SPS-based) excited state. The light emission of fac-[Mn(SPS)(CO)(3)] is largely quenched by the efficient photoisomerization occurring probably from a low-lying Mn-CO dissociative excited state. Density functional theory (DFT) and time-dependent DFT calculations describe the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) of fac- and mer-[Mn(CO)(3)(SPS)] as ligand-centered orbitals, largely localized on the phosphinine ring of the SPS pincer ligand. In line with the ligand nature of its frontier orbitals, fac-[Mn(SPS)(CO)(3)] is electrochemically reversibly oxidized and reduced to the corresponding radical cation and anion, respectively. The spectroscopic (electron paramagnetic resonance, IR, and UV-vis) characterization of the radical species provides other evidence for the localization of the redox steps on the SIPS ligand. The smaller HOMO-LUMO energy difference in the case of mer-[Mn(CO)(3)(SPS)], reflected in the electronic absorption and emission spectra, corresponds with its lower oxidation potential compared to that of the fac isomer. The thermodynamic instability of mer-[Mn(CO)(3)(SPS)], confirmed by the DFT calculations, increases upon one-electron reduction and oxidation of the complex.
Resumo:
Two new complex salts of the form (Bu4N)(2)[Ni(L)(2)] (1) and (Ph4P)(2)[Ni(L)(2)] (2) and four heteroleptic complexes cis-M(PPh3)(2)(L) [M = Ni(II) (3), Pd(II) (4), L = 4-CH3OC6H4SO2N=CS2] and cis-M(PPh3)(2)(L') [M = Pd(II) (5), Pt(II) (6), L' = C6H5SO2N=CS2] were prepared and characterized by elemental analyses, IR, H-1, C-13 and P-31 NMR and UV-Vis spectra, solution and solid phase conductivity measurements and X-ray crystallography. A minor product trans-Pd(PPh3)(2)(SH)(2), 4a was also obtained with the synthesis of 4. The NiS4 and MP2S2 core in the complex salts and heteroleptic complexes are in the distorted square-plane whereas in the trans complex, 4a the centrosymmetric PdS2P2 core is perforce square planar. X-ray crystallography revealed the proximity of the ortho phenyl proton of the PPh3 ligand to Pd(II) showing rare intramolecular C-H center dot center dot center dot Pd anagostic binding interactions in the palladium cis-5 and trans-4a complexes. The complex salts with sigma(rt) values similar to 10 (5) S cm (1) show semi-conductor behaviors. The palladium and platinum complexes show photoluminescence properties in solution at room temperature.
Resumo:
An aqueous solution of the α-ω-dicarboxylic acid octanedioic acid (odaH2) reacts with [Cu2(μ-O2CCH3)4(H2O)2] in the presence of an excess of pyridine (py) to give the crystalline copper(II) complex {Cu2(η1η1μ2-oda)2(py)4(H2O)2}n (1). structure of 1, as determined by X-ray crystallography, consists of polymeric chains in which bridging oda2− anions link two crystallographically identical copper atoms. The copper atoms are also ligated by two transoidal pyridine nitrogens and an oxygen atom from an apical water molecule, giving the metals an overall N2O3 square-pyramidal geometry. If the blue solid 1 is gently heated, or if it is left to stand in its mother liquor for prolonged periods, it loses one molecule of pyridine and half a molecule of water and the green complex {Cu (oda)(py)(H2O)0.5}n (2) is formed. Spectroscopic and magnetic data for both complexes are given, together with the electrochemical and thermogravimetric measurements for 1.
Resumo:
[Et3NH]4[Mo8O26] reacted with MgCl2 giving the triethylammonum magnesium β-octamolybdate(VI) salt [Et3NH]2[Mg(H2O)6Mo8O26]·2H2O (3) and the triethylammonium hydronium β-octaamolybdate(VI) salt [Et3NH]3[(H3O)Mo8O26·2H2O (4), respectively. A small amount of [Et3NH]2[Mo6O269] was formed as a by-product. The salts 3 and 4 were characterized by X-ray crystallography. The [Mg(H2O)6Mo8O26]2− moiety in 3 is polymeric, with each octahedral [Mg(H2O)6]2+ ion sandwiched between two β[Mo8O26]4− ions, being hydrogen bonded to three terminal MOO oxygen atoms on one face of each β[Mo8O26]4− ion. The X-ray crystal structure of 4 corresponds to the reported previously. IR and conductivity data are given for 3 and 4.
Resumo:
W(CO)6 reacts with a mixture of acetic acid/acetic anhydride to give [W3 (μ3-O)2(μ2η2-O2CCH3)6(H2O)3](CH3CO2)2 (1), which was converted by HClO4 to [W3 (μ3-O)2(μ2η2-O2CCH3)6(H2O)3](ClO4)2 (2). Addition of CH3CO2Na to the above reaction mixture, and prolonged exposure of the solution to air, results in the formation of the WIV/WVI complex salt [W3(μ3-O)2(μ2η2-O2CCH3)6(H2O)3]2[W10O32]·solvent (3). Complex 3 was also prepared by reacting 1 with Na2WO4·2H2O in acetic acid, and it has been characterized by X-ray crystallography. Addition of [CH3(CH2)3]4N(ClO4) to the reaction filtrate remaining after the preparation of [Mo2(μ-O2CCH3)4][from Mo(CO)6, CH3CO2H and (CH3CO)2O], followed by exposure to air, gives ([CH3(CH2)3]4N)2[Mo6O19] (4).
Resumo:
Naphthalene and anthracene transition metalates are potent reagents, but their electronic structures have remained poorly explored. A study of four Cp*-substituted iron complexes (Cp* = pentamethylcyclopentadienyl) now gives rare insight into the bonding features of such species. The highly oxygen- and water-sensitive compounds [K(18-crown- 6){Cp*Fe(η4-C10H8)}] (K1), [K(18-crown-6){Cp*Fe(η4-C14H10)}] (K2), [Cp*Fe(η4-C10H8)] (1), and [Cp*Fe(η4-C14H10)] (2) were synthesized and characterized by NMR, UV−vis, and 57Fe Mössbauer spectroscopy. The paramagnetic complexes 1 and 2 were additionally characterized by electron paramagnetic resonance (EPR) spectroscopy and magnetic susceptibility measurements. The molecular structures of complexes K1, K2, and 2 were determined by single-crystal X-ray crystallography. Cyclic voltammetry of 1 and 2 and spectroelectrochemical experiments revealed the redox properties of these complexes, which are reversibly reduced to the monoanions [Cp*Fe(η4-C10H8)]− (1−) and [Cp*Fe(η4-C14H10)]− (2−) and reversibly oxidized to the cations [Cp*Fe(η6-C10H8)]+ (1+) and [Cp*Fe(η6-C14H10)]+ (2+). Reduced orbital charges and spin densities of the naphthalene complexes 1−/0/+ and the anthracene derivatives 2−/0/+ were obtained by density functional theory (DFT) methods. Analysis of these data suggests that the electronic structures of the anions 1− and 2− are best represented by low-spin FeII ions coordinated by anionic Cp* and dianionic naphthalene and anthracene ligands. The electronic structures of the neutral complexes 1 and 2 may be described by a superposition of two resonance configurations which, on the one hand, involve a low-spin FeI ion coordinated by the neutral naphthalene or anthracene ligand L, and, on the other hand, a low-spin FeII ion coordinated to a ligand radical L•−. Our study thus reveals the redox noninnocent character of the naphthalene and anthracene ligands, which effectively stabilize the iron atoms in a low formal, but significantly higher spectroscopic oxidation state.
Resumo:
A mononuclear octahedral nickel(II) complex [Ni(HL(1))(2)](SCN)(2) (1) and an unusual penta-nuclear complex [{(NiL(2))(mu-SCN)}(4)Ni(NCS)(2)]center dot 2CH(3)CN (2) where HL(1) = 3-(2-aminoethylimino)butan-2-one oxime and HL(2) = 3-(hydroxyimino)butan-2-ylidene)amino)propylimino)butan-2-one oxime have been prepared and characterized by X-ray crystallography. The mono-condensed ligand, HL(1), was prepared by the 1:1 condensation of the 1,2-diaminoethane with diacetylmonoxime in methanol under high dilution. Complex 1 is found to be a mer isomer and the amine hydrogen atoms are involved in extensive hydrogen bonding with the thiocyanate anions. The dicondensed ligand, HL(2), was prepared by the 1:2 condensation of the 1,3-diaminopropane with diacetylmonoxime in methanol. The central nickel(II) in 2 is coordinated by six nitrogen atoms of six thiocyanate groups, four of which utilize their sulphur atoms to connect four NiL2 moieties to form a penta-nuclear complex and it is unique in the sense that this is the first thiocyanato bridged penta-nuclear nickel(II) compound with Schiff base ligands.
Resumo:
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.
Resumo:
A systematic approach is presented for obtaining cylindrical distribution functions (CDF's) of noncrystalline polymers which have been oriented by extension. The scattering patterns and CDF's are also sharpened by the method proposed by Deas and by Ruland. Data from atactic poly(methyl methacrylate) and polystyrene are analysed by these techniques. The methods could also be usefully applied to liquid crystals.
Resumo:
An experimental method is described which enables the inelastically scattered X-ray component to be removed from diffractometer data prior to radial density function analysis. At each scattering angle an energy spectrum is generated from a Si(Li) detector combined with a multi-channel analyser from which the coherently scattered component is separated. The data obtained from organic polymers has an improved signal/noise ratio at high values of scattering angle, and a commensurate enhancement of resolution of the RDF at low r is demonstrated for the case of PMMA (ICI `Perspex'). The method obviates the need for the complicated correction for multiple scattering.
Resumo:
A two-dimensional X-ray scattering system developed around a CCD-based area detector is presented, both in terms of hardware employed and software designed and developed. An essential feature is the integration of hardware and software, detection and sample environment control which enables time-resolving in-situ wide-angle X-ray scattering measurements of global structural and orientational parameters of polymeric systems subjected to a variety of controlled external fields. The development and operation of a number of rheometers purpose-built for the application of such fields are described. Examples of the use of this system in monitoring degrees of shear-induced orientation in liquid-crystalline systems and crystallization of linear polymers subsequent to shear flow are presented.