Differences between the gut microflora of children with autistic spectrum disorders and that of healthy children

Children with autistic spectrum disorders (ASDs) tend to suffer from severe gastrointestinal problems. Such symptoms may be due to a disruption of the indigenous gut flora promoting the overgrowth of potentially pathogenic micro-organisms. The faecal flora of patients with ASDs was studied and compared with those of two control groups (healthy siblings and unrelated healthy children). Faecal bacterial populations were assessed through the use of a culture-independent technique, fluorescence in situ hybridization, using oligonucleotide probes targeting predominant components of the gut flora. The faecal flora of ASD patients contained a higher incidence of the Clostridium histolyticum group (Clostridium clusters I and 11) of bacteria than that of healthy children. However, the non-autistic sibling group had an intermediate level of the C. histolyticum group, which was not significantly different from either of the other subject groups. Members of the C. histolyticum group are recognized toxin-producers and may contribute towards gut dysfunction, with their metabolic products also exerting systemic effects. Strategies to reduce clostridial population levels harboured by ASD patients or to improve their gut microflora profile through dietary modulation may help to alleviate gut disorders common in such patients.

Identification of hepatic molecular mechanisms of action of alpha-tocopherol using global gene expression profile analysis in rats

The recent discovery that vitamin E (VE) regulates gene activity at the transcriptional level indicates that VE may exert part of its biological effects by mechanisms which may be independent of its well-recognised antioxidant function. The objective of this study was the identification of hepatic vitamin E-sensitive genes and examination of the effects of VE on their corresponding biological endpoints. Two groups of male rats were randomly assigned to either a VE-sufficient diet or to a control diet deficient in VE for 290 days. High-density oligonucleotide microarrays comprising over 7000 genes were used to assess the transcriptional response of the liver. Differential gene expression was monitored over a period of 9 months, at four different time-points, and rats were individually profiled. This experimental strategy identified several VE-sensitive genes, which were chronically altered by dietary VE. VE supplementation down-regulated scavenger receptor CD36, coagulation factor IX and 5-alpha-steroid reductase type 1 mRNA levels while hepatic gamma glutamyl-cysteinyl synthetase was significantly up-regulated. Measurement of the corresponding biological endpoints such as activated partial thromboplastin time, plasma dihydrotestosterone and hepatic glutathione substantiated the gene chip data which indicated that dietary VE plays an important role in a range of metabolic processes within the liver. (C) 2004 Elsevier B.V. All rights reserved.

Drug interaction and location in liposomes: correlation with polar surface areas

An important step in liposome characterization is to determine the location of a drug within the liposome. This work thus investigated the interaction of dipalmitoylphosphatidylcholine liposomes with drugs of varied water solubility, polar surface area (PSA) and partition coefficient using high sensitivity differential scanning calorimetry. Lipophilic estradiol (ES) interacted strongest with the acyl chains of the lipid membrane, followed by the somewhat polar 5-fluorouracil (5-FU). Strongly hydrophilic mannitol (MAN) showed no evidence of interaction but water soluble polymers inulin (IN) and an antisense oligonucleotide (OLG), which have very high PSAs, interacted with the lipid head groups. Accordingly, the drugs could be classified as: hydrophilic ones situated in the aqueous core and which may interact with the head groups; those located at the water-bilayer interface with some degree of penetration into the lipid bilayer; those lipophilic drugs constrained within the bilayer. (c) 2004 Elsevier B.V. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Effects of a novel galactooligosaccharide on the faecal microbiota of healthy and inflammatory bowel disease cats during a randomized, double-blind, cross-over feeding study

Inflammatory bowel disease (IBD) is a common gastrointestinal disorder of cats with no known aetiological agent. Previous work has suggested that the faecal microbiota of IBD cats is significantly different from that of healthy cats, including significantly lower bifidobacteria, bacteroides and total counts in IBD cats and significantly lower levels of sulfate-reducing bacteria in healthy cats. Prebiotics, including galactooligosaccharides (GOS), have been shown to elicit a bifidogenic effect in humans and other animals. The purpose of the current study was to examine the impact of a novel GOS supplementation on the faecal microbiota of healthy and IBD cats during a randomized, double-blind, cross-over feeding study. Eight oligonucleotide probes targeting specific bacterial populations and DAPI stain (total bacteria) were used to monitor the feline faecal microbiota. Overall, inter-animal variation was high; while a trend of increased bifidobacterial levels was seen with GOS supplementation it was not statistically significant in either healthy or IBD cats. No significant differences were observed in the faecal microbiota of IBD cats and healthy cats fed the same diet. Members of the family Coriobacteriaceae (Atopobium cluster) were found to be the most abundant bacteria in the feline microbiota.

Application of molecular biological methods for studying probiotics and the gut flora

Increasingly, the microbiological scientific community is relying on molecular biology to define the complexity of the gut flora and to distinguish one organism from the next. This is particularly pertinent in the field of probiotics, and probiotic therapy, where identifying probiotics from the commensal flora is often warranted. Current techniques, including genetic fingerprinting, gene sequencing, oligonucleotide probes and specific primer selection, discriminate closely related bacteria with varying degrees of success. Additional molecular methods being employed to determine the constituents of complex microbiota in this area of research are community analysis, denaturing gradient gel electrophoresis (DGGE)/temperature gradient gel electrophoresis (TGGE), fluorescent in situ hybridisation (FISH) and probe grids. Certain approaches enable specific aetiological agents to be monitored, whereas others allow the effects of dietary intervention on bacterial populations to be studied. Other approaches demonstrate diversity, but may not always enable quantification of the population. At the heart of current molecular methods is sequence information gathered from culturable organisms. However, the diversity and novelty identified when applying these methods to the gut microflora demonstrates how little is known about this ecosystem. Of greater concern is the inherent bias associated with some molecular methods. As we understand more of the complexity and dynamics of this diverse microbiota we will be in a position to develop more robust molecular-based technologies to examine it. In addition to identification of the microbiota and discrimination of probiotic strains from commensal organisms, the future of molecular biology in the field of probiotics and the gut flora will, no doubt, stretch to investigations of functionality and activity of the microflora, and/or specific fractions. The quest will be to demonstrate the roles of probiotic strains in vivo and not simply their presence or absence.

Regulation of expression of the rat orthologue of mouse double minute 2 (MDM2) by H2O2-induced oxidative stress in neonatal rat cardiac myocytes.

The Mdm2 ubiquitin ligase is an important regulator of p53 abundance and p53-dependent apoptosis. Mdm2 expression is frequently regulated by a p53 Mdm2 autoregulatory loop whereby p53 stimulates Mdm2 expression and hence its own degradation. Although extensively studied in cell lines, relatively little is known about Mdm2 expression in heart where oxidative stress (exacerbated during ischemia-reperfusion) is an important pro-apoptotic stimulus. We demonstrate that Mdm2 transcript and protein expression are induced by oxidative stress (0.2 mm H(2)O(2)) in neonatal rat cardiac myocytes. In other cells, constitutive Mdm2 expression is regulated by the P1 promoter (5' to exon 1), with inducible expression regulated by the P2 promoter (in intron 1). In myocytes, H(2)O(2) increased Mdm2 expression from the P2 promoter, which contains two p53-response elements (REs), one AP-1 RE, and two Ets REs. H(2)O(2) did not detectably increase expression of p53 mRNA or protein but did increase expression of several AP-1 transcription factors. H(2)O(2) increased binding of AP-1 proteins (c-Jun, JunB, JunD, c-Fos, FosB, and Fra-1) to an Mdm2 AP-1 oligodeoxynucleotide probe, and chromatin immunoprecipitation assays showed it increased binding of c-Jun or JunB to the P2 AP-1 RE. Finally, antisense oligonucleotide-mediated reduction of H(2)O(2)-induced Mdm2 expression increased caspase 3 activation. Thus, increased Mdm2 expression is associated with transactivation at the P2 AP-1 RE (rather than the p53 or Ets REs), and Mdm2 induction potentially represents a cardioprotective response to oxidative stress.

Glycogen synthase kinases 3α and 3β in cardiac myocytes: regulation and consequences of their inhibition

Inhibition of glycogen synthase kinase 3β (GSK3β) as a consequence of its phosphorylation by protein kinase B/Akt (PKB/Akt) has been implicated in cardiac myocyte hypertrophy in response to endothelin-1 or phenylephrine. We examined the regulation of GSK3α (which we show to constitute a significant proportion of the myocyte GSK3 pool) and GSK3β in cardiac myocytes. Although endothelin increases phosphorylation of GSK3 and decreases its activity, the response is less than that induced by insulin (which does not promote cardiac myocyte hypertrophy). GSK3 phosphorylation induced by endothelin requires signalling through the extracellular signal-regulated kinase 1/2 (ERK1/2) cascade and not the PKB/Akt pathway, whereas the reverse is true for insulin. Cardiac myocyte hypertrophy involves changes in morphology, and in gene and protein expression. The potent GSK3 inhibitor 1-azakenpaullone increases myocyte area as a consequence of increased cell length whereas phenylephrine increases both length and width. Azakenpaullone or insulin promotes AP1 transcription factor binding to an AP1 consensus oligonucleotide, but this was significantly less than that induced by endothelin and derived principally from increased binding of JunB protein, the expression of which was increased. Azakenpaullone promotes significant changes in gene expression (assessed by Affymetrix microarrays), but the overall response is less than with endothelin and there is little overlap between the genes identified. Thus, although GSK3 may contribute to cardiac myocyte hypertrophy in some respects (and presumably plays an important role in myocyte metabolism), it does not appear to contribute as significantly to the response induced by endothelin as has been maintained.

Gene-chip technology and its applications

Gene Chips are finding extensive use in animal and plant science. Generally microarrays are of two kind, cDNA or oligonucleotide. cDNA microarrays were developed at Stanford University, whereas oligonucleotide were developed by Affymetrix. The construction of cDNA or oligonucleotide on a glass slide helps to compare the gene expression level of treated and control samples by labeling mRNA with green (Cy3) and red (Cy5) dyes. The hybridized gene chip emit fluorescence whose intensity and colour can be measured. RNA labeling can be done directly or indirectly. Indirect method involves amino allyle modified dUTP instead of pre-labelled nucleotide. Hybridization of gene chip generally occurs in a minimum volume possible and to ensure the hetroduplex formation, a ten fold more DNA is spotted on slide than in the solutions. A confocal or semi confocal laser technologies coupled with CCD camera are used for image acquisition. For standardization, house keeping genes are used or cDNA are spotted in gene chip that are not present in treated or control samples. Moreover, statistical analysis (image analysis) and cluster analysis softwares have been developed by Stanford University. The gene-chip technology has many applications like expression analysis, gene expression signatures (molecular phenotypes) and promoter regulatory element co-expression.

Structure determination of an intercalating ruthenium dipyridophenazine complex which kinks DNA by semiintercalation of a tetraazaphenanthrene ligand

We describe a crystal structure, at atomic resolution (1.1 Å, 100 K), of a ruthenium polypyridyl complex bound to duplex DNA, in which one ligand acts as a wedge in the minor groove, resulting in the 51° kinking of the double helix. The complex cation Λ-[Ru(1,4,5,8-tetraazaphenanthrene)2(dipyridophenazine)]2+ crystallizes in a 1∶1 ratio with the oligonucleotide d(TCGGCGCCGA) in the presence of barium ions. Each complex binds to one duplex by intercalation of the dipyridophenazine ligand and also by semiintercalation of one of the orthogonal tetraazaphenanthrene ligands into a second symmetrically equivalent duplex. The result is noncovalent cross-linking and marked kinking of DNA.

Structural characterisation of bisintercalation in higher-order DNA at a junction-like quadruplex

We report the single-crystal X-ray structure for the complex of the bisacridine bis-(9-aminooctyl(2-(dimethylaminoethyl)acridine-4-carboxamide)) with the oligonucleotide d(CGTACG)2 to a resolution of 2.4 Å. Solution studies with closed circular DNA show this compound to be a bisintercalating threading agent, but so far we have no crystallographic or NMR structural data conforming to the model of contiguous intercalation within the same duplex. Here, with the hexameric duplex d(CGTACG), the DNA is observed to undergo a terminal cytosine base exchange to yield an unusual guanine quadruplex intercalation site through which the bisacridine threads its octamethylene linker to fuse two DNA duplexes. The 4-carboxamide side-chains form anchoring hydrogen-bonding interactions with guanine O6 atoms on each side of the quadruplex. This higher-order DNA structure provides insight into an unexpected property of bisintercalating threading agents, and suggests the idea of targeting such compounds specifically at four-way DNA junctions.

Determination of the in vivo prebiotic potential of a maize based wholegrain breakfast cereal: a human feeding study

Epidemiological studies have shown an inverse relationship between risk of CVD and intake of whole grain (WG)-rich food. Regular consumption of breakfast cereals can provide not only an increase in dietary WG but also improvements to cardiovascular health. Various mechanisms have been proposed, including prebiotic modulation of the colonic microbiota. In the present study, the prebiotic activity of a maize-derived WG cereal (WGM) was evaluated in a double-blind, placebo-controlled human feeding study (n 32). For a period of 21 d, healthy men and women, mean age 32 (sd 8) years and BMI 23·3 (sd 0·58) kg/m2, consumed either 48 g/d WG cereal (WGM) or 48 g placebo cereal (non-whole grain (NWG)) in a crossover fashion. Faecal samples were collected at five points during the study on days 0, 21, 42, 63 and 84 (representing at baseline, after both treatments and both wash-out periods). Faecal bacteriology was assessed using fluorescence in situ hybridisation with 16S rRNA oligonucleotide probes specific for Bacteroides spp., Bifidobacterium spp., Clostridium histolyticum/perfringens subgroup, Lactobacillus–Enterococcus subgroup and total bacteria. After 21 d consumption of WGM, mean group levels of faecal bifidobacteria increased significantly compared with the control cereal (P = 0·001). After a 3-week wash-out period, bifidobacterial levels returned to pre-intervention levels. No statistically significant changes were observed in serum lipids, glucose or measures of faecal output. In conclusion, this WG maize-enriched breakfast cereal mediated a bifidogenic modulation of the gut microbiota, indicating a possible prebiotic mode of action

Genetic diversity among Escherichia coli O157 : H7 isolates and identification of genes linked to human infections

An Escherichia coli oligonucleotide microarray based on three sequenced genomes was validated for comparative genomic microarray hybridization and used to study the diversity of E. coli O157 isolates from human infections and food and animal sources. Among 26 test strains, 24 (including both Shiga toxin [Stx]-positive and -negative strains) were found to be related to the two sequenced E. coli O157:117 strains, EDL933 and Sakai. However, these strains showed much greater genetic diversity than those reported previously, and most of them could not be categorized as either lineage I or H. Some genes were found more often in isolates from human than from nonhuman sources; e.g., ECs1202 and ECs2976, associated with stx2AB and stx1AB, were in all isolates from human sources but in only 40% of those from nonhuman sources. Some (but not all) lineage I-specific or -dominant genes were also more frequently associated with isolates from human. The results suggested that it might be more effective to concentrate our efforts on finding markers that are directly related to infection rather than those specific to certain lineages. In addition, two Stx-negative O157 cattle isolates (one confirmed to be 117) were significantly different from other Stx-positive and -negative E. coli O157:117 strains and were more similar to MG1655 in their gene content. This work demonstrates that not all E. coli O157:117 strains belong to the same clonal group, and those that were similar to E. coli K-12 might be less virulent.

Crystal structures of Λ-[Ru(phen)2dppz]2+ with oligonucleotides containing TA/TA and AT/AT steps show two intercalation modes

The ruthenium complex [Ru(phen)2(dppz)] (where phen is a phenanthroline and dppz a dipyridyl–phenazine ligand) is known as a ‘light switch’ complex because its luminescence in solution is significantly enhanced in the presence of DNA. This property is poised to serve in diagnostic and therapeutic applications, but its binding mode with DNA needs to be elucidated further. Here, we describe the crystal structures of the L enantiomer bound to two oligonucleotide duplexes. The dppz ligand intercalates symmetrically and perpendicularly from the minor groove of the d(CCGGTACCGG)2 duplex at the central TA/TA step, but not at the central AT/AT step of d(CCGGATCCGG)2. In both structures, however, a second ruthenium complex links the duplexes through the combination of a shallower angled intercalation into the C1C2/G9G10 step at the end of the duplex, and semi-intercalation into the G3G4 step of an adjacent duplex. The TA/TA specificity of the perpendicular intercalation arises from the packing of phenanthroline ligands against the adenosine residue.

The development of a ligase mediated PCR with potential for the differentiation of serovars within Leptospira interrogans

A ligase mediated polymerase chain reaction (LMPCR) was developed to amplify between the repetitive element, IS1533, of Leptospira and adjacent chromosomally located BglII restriction endonuclease enzyme sites. To do this, complimentary oligonucleotide linkers designed to anneal together with an overhanging BglII end were ligated to BglII digested DNA from 35 leptospiral reference strains and field isolates, This ligated DNA was used as template for PCR with oligonucleotide primers specific for the linker and for the repetitive element IS1533. The resultant amplicon profile hybridised a 102 hp region derived from the terminus of IS1533 thus confirming that amplicons generated by LMPCR contained part of IS1533. The number of fragments generated containing IS1533 was significantly fewer than that generated by RFLP but the LMPCR method has the potential to use far less template DNA and be quicker than standard RFLP. Obvious and reproducible interserovar differences were demonstrated by LMPCR whereas for 20 of 21 L. hardjo-bovis isolates tested no intraserovar differences were observed. Of those serovars known to possess IS1533 homologues and tested here by LMPCR, each produced a unique amplicon profile which hybridised the IS1533 terminus probe. The limited heterogeneity amongst hardjo-bovis isolates is discussed as is the potential contribution of this method to diagnosis, differentiation and the phylogenetics of the Leptospires.