5-Fluorouracil: mechanisms of action and clinical strategies

5-fluorouracil (5-FU) is widely used in the treatment of cancer. Over the past 20 years, increased understanding of the mechanism of action of 5-FU has led to the development of strategies that increase its anticancer activity. Despite these advances, drug resistance remains a significant limitation to the clinical use of 5-FU. Emerging technologies, such as DNA microarray profiling, have the potential to identify novel genes that are involved in mediating resistance to 5-FU. Such target genes might prove to be therapeutically valuable as new targets for chemotherapy, or as predictive biomarkers of response to 5-FU-based chemotherapy.

BRCA1 regulates the interferon gamma-mediated apoptotic response

BRCA1 is a tumor suppressor gene implicated in transcriptional regulation. We have generated cell lines with inducible expression of BRCA1 as a tool to identify downstream targets that may be important mediators of BRCA1 function. Oligonucleotide array-based expression profiling identified 11 previously described interferon regulated genes that were up-regulated following inducible expression of BRCA1. Northern blot analysis revealed that a subset of the identified targets including IRF-7, MxA, and ISG-54 were synergistically up-regulated by BRCA1 in the presence of interferon gamma (IFN-gamma) but not interferons alpha or beta. Importantly, IFN-gamma-mediated induction of IRF-7 and MxA was attenuated in the BRCA1 mutant cell line HCC1937, an effect that was rescued following reconstitution of exogenous wild type BRCA1 in these cells. Furthermore, reconstituted BRCA1 sensitized HCC1937 cells to IFN-gamma-induced apoptotic cell death. This study identifies BRCA1 as a component of the IFN-gamma-regulated signaling pathway and suggests that BRCA1 may play a role in the regulation of IFN-gamma-mediated apoptosis.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Detection of a single DNA base-pair mismatch using an anthracene-tagged fluorescent probe

A novel anthracene-tagged oligonucleotide can discriminate between a fully-matched DNA target sequence and one with a single mismatching base-pair through a remarkable difference in fluorescence emission intensity upon duplex formation.

Phase II study of ISIS 3521, an antisense oligodeoxynucleotide to protein kinase C alpha, in patients with previously treated low-grade non-Hodgkin's lymphoma

Background: The purpose of this study was to assess the efficacy and safety of ISIS 3521, an antisense phosphorothioate oligonucleotide to protein kinase C in patients with relapsed low-grade non-Hodgkin's lymphoma (NHL). Patients and methods: Twenty-six patients received ISIS 3521 (2 mg/kg/day) as a continuous infusion over 21 days of each 28-day cycle. Results: The median age of the patients was 53 years (range 37–77). Histological subtypes were low-grade follicular lymphoma (n=22) and B-cell small lymphocytic lymphoma (n=4). Twenty-one (81%) had stage III/IV disease. The median number of previous lines of chemotherapy was two (range one to six). A total of 87 cycles of ISIS 3521 were administered. Twenty-three patients were assessable for response. Three patients achieved a partial response. No complete responses were observed. Ten patients had stable disease. Grade 3–4 toxicity was as follows: neutropenia (3.8%) and thrombocytopenia (26.9%). Conclusions: ISIS 3521 has demonstrated anti-tumour activity in patients with relapsed low-grade NHL. There may be a potential role for this agent in combination with conventional chemotherapy for advanced low-grade lymphoma, and further trials are warranted.

Analysis of DNA processing reactions in bacterial conjugation by using suicide oligonucleotides

Protein TrwC is the conjugative relaxase responsible for DNA processing in plasmid R388 bacterial conjugation. TrwC has two catalytic tyrosines, Y18 and Y26, both able to carry out cleavage reactions using unmodified oligonucleotide substrates. Suicide substrates containing a 30-Sphosphorothiolate linkage at the cleavage site displaced TrwC reaction towards covalent adducts and thereby enabled intermediate steps in relaxase reactions to be investigated. Two distinct covalent TrwC–oligonucleotide complexes could be separated from noncovalently bound protein by SDS–PAGE. As observed by mass spectrometry, one complex contained a single, cleaved oligonucleotide bound to Y18, whereas the other contained two cleaved oligonucleotides, bound to Y18 and Y26. Analysis of the cleavage reaction using suicide substrates and Y18F or Y26F mutants showed that efficient Y26 cleavage only occurs after Y18 cleavage. Strand-transfer reactions carried out with the isolated Y18–DNA complex allowed the assignment of specific roles to each tyrosine. Thus, only Y18 was used for initiation. Y26 was specifically used in the second transesterification that leads to strand transfer, thus catalyzing the termination reaction that occurs in the recipient cell.

Genomotyping of Pseudomonas putida strains using P-putida KT2440-based high-density DNA microarrays: implications for transcriptomics studies

Pseudomonas putida KT2440 is the only fully sequenced P. putida strain. Thus, for transcriptomics and proteomics studies with other P. putida strains, the P. putida KT2440 genomic database serves as standard reference. The utility of KT2440 whole-genome, high-density oligonucleotide microarrays for transcriptomics studies of other Pseudomonas strains was investigated. To this end, microarray hybridizations were performed with genomic DNAs of subcultures of P. putida KT2440 (DSM6125), the type strain (DSM291(T)), plasmid pWW0-containing KT2440-derivative strain mt-2 (DSM3931), the solvent-tolerant P. putida S12, and several other Pseudomonas strains. Depending on the strain tested, 22 to 99% of all genetic elements were identified in the genomic DNAs. The efficacy of these microarrays to study cellular function was determined for all strains included in the study. The vast majority of DSM6125 genes encoding proteins of primary metabolism and genes involved in the catabolism of aromatic compounds were identified in the genomic DNA of strain S12: a prerequisite for reliable transcriptomics analyses. The genomotypic comparisons between Pseudomonas strains were used to construct highly discriminative phylogenetic relationships. DSM6125 and DSM3931 were indistinguishable and clustered together with strain S12 in a separate group, distinct from DSM291(T). Pseudomonas monteilii (DSM14164) clustered well with P. putida strains.

Molecular diversity of the HLA-C gene identified in a Caucasian population

A DNA typing procedure, based on a two stage polymerase chain reaction-sequence-specific oligonucleotide probe (PCR-SSOP) typing strategy, has been developed and applied to DNA from 1000 healthy individuals from the Northern Ireland region. The two-stage procedure involves human leukocyte antigen (HLA-C) identification through the use of a medium resolution PCR-SSOP system, followed by four secondary group specific PCR-SSOP systems, to enable allele resolution. The PCR-SSOP systems were designed for the identification of HLA-Cw alleles with possible discrimination within exons 2 and 3 of the HLA-C gene, i.e., HLA-Cw*01-Cw*16. PCR-SSP tests were designed for the resolution of HLA-Cw*17 and -Cw*18 alleles. The systems can also be used independently of each other if selective allele resolution is required. HLA-Cw allele frequencies occuring within the Northern Ireland population have been compiled, along with estimations of HLA-B/Cw haplotype frequencies. (C) American Society for Histocompatibility and Immunogenetics, 2002. Published by Elsevier Science Inc.

Targets of genome copy number reduction in primary breast cancers identified by integrative genomics

The identification of specific oncogenes and tumor suppressor genes in regions of recurrent aneuploidy is a major challenge of molecular cancer research. Using both oligonucleotide single-nucleotide polymorphism and mRNA expression arrays, we integrated genomic and transcriptional information to identify and prioritize candidate cancer genes in regions of increased and decreased chromosomal copy number in a cohort of primary breast cancers. Confirming the validity of this approach, several regions of previously-known copy number (CN) alterations in breast cancer could be successfully reidentified. Focusing on regions of decreased CN, we defined a prioritized list of eighteen candidate genes, which included ARPIN, FBNI, and LZTSI, previously shown to be associated with cancers in breast or other tissue types, and novel genes such as P29, MORF4LI, and TBCID5. One such gene, the RUNX3 transcription factor, was selected for further study. We show that RUNX3 is present at reduced CNs in proportion to the rest of the tumor genome and that RUNX3 CN reductions can also be observed in a breast cancer series from a different center. Using tissue microarrays, we demonstrate in an independent cohort of over 120 breast tissues that RUNX3 protein is expressed in normal breast epithelium but not fat and stromal tissue, and widely down-regulated in the majority of breast cancers (> 85%). In vitro, RUNX3 overexpression suppressed the invasive potential of MDA-MB-231 breast cancer cells in a matrigel assay. Our results demonstrate the utility of integrative genomic approaches to identify novel potential cancer-related genes in primary tumors. This article contains Supplementary Material available at http:// www.interscience.wiley.com/jpages/1045-2257/suppmat. (c) 2006 Wiley-Liss, Inc.

A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex

DNA telomeric repeats in mammalian cells are transcribed to guanine-rich RNA sequences, which adopt parallel-stranded G-quadruplexes with a propeller-like fold. The successful crystallization and structure analysis of a bimolecular human telomeric RNA G-quadruplex, folded into the same crystalline environment as an equivalent DNA oligonucleotide sequence, is reported here. The structural basis of the increased stability of RNA telomeric quadruplexes over DNA ones and their preference for parallel topologies is described here. Our findings suggest that the 2'-OH hydroxyl groups in the RNA quadruplex play a significant role in redefining hydration structure in the grooves and the hydrogen bonding networks. The preference for specific nucleotides to populate the C3'-endo sugar pucker domain is accommodated by alterations in the phosphate backbone, which leads to greater stability through enhanced hydrogen bonding networks. Molecular dynamics simulations on the DNA and RNA quadruplexes are consistent with these findings. The computations, based on the native crystal structure, provide an explanation for RNA G-quadruplex ligand binding selectivity for a group of naphthalene diimide ligands as compared to the DNA G-quadruplex.

Apo J/clusterin expression and secretion: Evidence for 15-deoxy-Δ12,14-PGJ2-dependent mechanism

Cyclooxygenase-2 (Cox-2) and Apo J/clusterin are involved in inflammatory resolution and have each been reported to inhibit NF-?B signalling. Using a well-validated rat pheochromocytoma (PC12) cell culture model of Cox-2 over-expression the current study investigated inter-dependence between Cox-2 and clusterin with respect to induction of expression and impact on NF-?B signalling. Both gene expression and immunoblot analysis confirmed that intracellular and secreted levels of clusterin were elevated in Cox-2 over-expressing cells (PCXII). Clusterin expression was increased in control (PCMT) cells in a time- and dose-dependent manner by 15-deoxy-? 12,14-prostaglandin J 2 (15d-PGJ 2), but not PGE 2, and inhibited in PCXII cells by pharmacological Cox inhibition. In PCXII cells, inhibition of two transcription factors known to be activated by 15d-PGJ 2, heat shock factor 1 (HSF-1) and peroxisome proliferator activated receptor (PPAR)?, by transcription factor oligonucleotide decoy and antagonist (GW9662) treatment, respectively, reduced clusterin expression. While PCXII cells exhibited reduced TNF-a-induced cell surface ICAM-1 expression, IkB phosphorylation and degradation were similar to control cells. With respect to the impact of Cox-2-dependent clusterin upregulation on NF-?B signalling, basal levels of I?B were similar in control and PCXII cells, and no evidence for a physical association between clusterin and phospho-I?B was obtained. Moreover, while PCXII cells exhibited reduced NF-?B transcriptional activity, this was not restored by clusterin knock-down. These results indicate that Cox-2 induces clusterin in a 15d-PGJ 2-dependent manner, and via activation of HSF-1 and PPAR?. However, the results do not support a model whereby Cox-2/15d-PGJ 2-dependent inhibition of NF-?B signalling involves clusterin.

IR laser desorption of oligonucleotides A novel gas phase target for radiation damage studies

The desorption of oligonucleotides by 3 mu m laser irradiation has been studied by laser induced fluorescence imaging of the resulting gas phase plumes. Fitting of the plume data has been achieved by using a modified Maxwell Boltzmann distribution which incorporates a range of stream velocities. Spatial density profiles, velocities and temperature variation have been determined from these fits indicating that the oligonucleotide plume only achieves a partial thermal relaxation. This laser desorption technique may provide a means of overcoming the limited mass range of gas phase biomolecules available from thermal evaporation techniques.

Identification of Burkholderia cenocepacia genes required for bacterial survival in vivo

Burkholderia cenocepacia (formerly Burkholderia cepacia complex genomovar III) causes chronic lung infections in patients with cystic fibrosis. In this work, we used a modified signature-tagged mutagenesis (STM) strategy for the isolation of B. cenocepacia mutants that cannot survive in vivo. Thirty-seven specialized plasposons, each carrying a unique oligonucleotide tag signature, were constructed and used to examine the survival of 2,627 B. cenocepacia transposon mutants, arranged in pools of 37 unique mutants, after a 10-day lung infection in rats by using the agar bead model. The recovered mutants were screened by real-time PCR, resulting in the identification of 260 mutants which presumably did not survive within the lungs. These mutants were repooled into smaller pools, and the infections were repeated. After a second screen, we isolated 102 mutants unable to survive in the rat model. The location of the transposon in each of these mutants was mapped within the B. cenocepacia chromosomes. We identified mutations in genes involved in cellular metabolism, global regulation, DNA replication and repair, and those encoding bacterial surface structures, including transmembrane proteins and cell surface polysaccharides. Also, we found 18 genes of unknown function, which are conserved in other bacteria. A subset of 12 representative mutants that were individually examined using the rat model in competition with the wild-type strain displayed reduced survival, confirming the predictive value of our STM screen. This study provides a blueprint to investigate at the molecular level the basis for survival and persistence of B. cenocepacia within the airways.

Erythropoietin production in kidney tubular cells

The erythropoietin gene has been cloned in three mammalian species including man and recombinant erythropoietin is now used to treat the anaemia of chronic renal failure. Despite the isolation of the gene the precise cellular location of erythropoietin synthesis remains controversial. We present studies which demonstrate erythropoietin production by kidney tubular cells. Erythropoietin gene expression (messenger RNA) was detected by in situ hybridization using an oligonucleotide gene probe and the translated protein product by immunohistochemistry employing antibodies raised to pure recombinant DNA derived erythropoietin.

TP53 R249S Mutations, Exposure to Aflatoxin, and Occurrence of Hepatocellular Carcinoma in a Cohort of Chronic Hepatitis B Virus Carriers from Qidong, China

Hepatocellular carcinoma (HCC) has a high mortality in East Asia and Sub-Saharan Africa, two regions where the main etiologic factors are chronic infections with hepatitis B vir-us and dietary exposure to aflatoxin. A single base substitution at the third nucleotide of codon 249 of TP53 (R249S) is common in HCC in these regions and has been associated with aflatoxin-DNA adducts. To determine whether R249S may be detected in plasma DNA before HCC diagnosis, we conducted a case-control study nested in a cohort of adult chronic hepatitis B virus carriers from Qidong County, People's Republic of China. Of the 234 plasma specimens that yielded adequate DNA, only 2 (0.9%) were positive for R249S by restriction fragment length polymorphisms, and both of them were controls. Of the 249 subjects tested for aflatoxin-albumin adducts, 168 (67%) were positive, with equal distribution between cases and controls. Aflatoxin-albumin adduct levels were low in the study, suggesting an overall low ongoing exposure to aflatoxin in this cohort. The R249S mutation was detected in 11 of 18 (61%) available tumor tissues. To assess whether low levels of mutant DNA were detectable in pre-diagnosis plasma, 14 plasma specimens from these patients were analyzed by short oligonucleotide mass analysis. Nine of them (64%) were found to be positive. Overall, these results suggest that HCC containing R249S can occur in the absence of significant recent exposure to aflatoxins. The use of short oligonucleotide mass analysis in the context of low ongoing aflatoxin exposure may allow the detection of R249S in plasma several months ahead of clinical diagnosis. (Cancer Epidemiol Biomarkers Prev 2009;18(5):1638-43)